Description :
From Genome Similarity Track
Location :
Scaffold_39:71416- 76376
Sequence
4960 bases(100 bases per row)
GGCAGCCAGTGCGGCCGCCTTAGCGTCGCTTTATCCAGCCATTGAGCCCATAAACCGTTCGATTGCATTGCGCTTGAGTGTTGGAGTGTTGAGTAGATTC
TGCATTGATAGTGCTCTTCTGTTGCTGCTGATGCACTACCTATCTGCTATCTCTAGCTGCCACTCACTTTCCAGCTCTGCTGCTAGCCACTCAAACGCAT
CTTTCTTATATCTCTCTGCACAAAAATGTGACTTGTGCACACGAATCGGCGCGCCTTTTCAAGCGCACCAAAATTCCACATGGCCTCGCGTCTATTTCTA
ACACTTGGTGTACGATGACGACGTGGTGCATCACTGGAAGCTATATTAAACACGACAGATCAAGTCAAATAAAGCACAAACAACAATCTAAATTGATTGT
TCGTGATGCGTGCGAATTCCATCTACTTATTGGGATGATCGAACATACGGATGATGTCACTATGTGTCAATGGAGCTATCATTATGACATAATAATACGA
TTTGGTATGTAAGCATTCTTTGATTCCGGTTGACATCAGCATAAAATGGTAATAATTGAAAATGGAGAACTACAATCGATGATCCGCACTATAAAGCTGT
AGATGCACGTATATAATGTGTGTAAATCGACCATATGTTGCCTAAGCCGTTGTAATGGTTGCTTTAAGCTCCCTCAAACTGTACTTTGTACTGCATTAAA
ATGTACATTTCGGTAATTATAAGGTCCTACATCACGTGGGATTTTAATTAAACGAAGTGATGCTTTAGATTAAGAGTGCATTGTGGACGCAGACAAAGCC
GGCGACATTACAGAACAAAAGTTGACATTAGTTAGCGTTTATATAGCACTAGATTTCTGTAAGCTGGAGAATCAAATACCACACAAGTGGCTTACGTTCA
CAGAGCGATGCTTAATACATCGCGCTAATTCTGGCAAATCATGAAGGGACTAAGTGATTTTTAGAGTCGTGAGTCTTCCTCTGACTAGGAGTTTTGTAGC
TCCACTACACAAGATCCAAGTGTAGTGGAGCTACACAGCTATTAGTTAGAGGAAGACTTTCGACTCTAGAAGTCACTTGGTTCTACAGAACCAAGTTCCT
ATTCGTTTAGAGAGCCACTTGTTCTGATAACTAATCAACGAAGACTCGCAGAGAGTCTTCACGCTTGTAGAGCTTCTAGTCCTGGTTAAGGAGACTAACA
ACGATTCGAAGATCTTACGCACAAAGTGTCCAGAGTACTCGCCACAAGAAGACTCTTACTCGTTGCGATCTGCCGACGTCTAAATTAGACACGTATCAAC
AAGAGATCAAAAGGGGAACTGTTATTTTATCTTTAAGATTTATCTGTAATAAACCTCATTCAACTACCTAATACTAAGGTTAAACTAATTCTCATAATAA
TCCTTAGTATCCTAATAGATCGACGGATGGTACATCAACCTGTCATTAATGGATGACGGAGGTTATCAACGACATCAATTATCACAGATAAAAGTTGGGA
TTATATATCATATATACAAGGTGTATTCCTTTCGGACGGTAATGGTAGTGTGACCCCGTTACAACAAGTATATCGACAACAATGTCAGCACCATCGCATA
GGTGAAATCAAATGTAGTCAGAGTTGATTACTACAGCACTTCGTAGATGTTGGCAGTTTTTTACCCAAAGGACTTCCTGGCGCAATAAACCAGAGCCTTA
CTCGCACATATTAGTGAATCGCTATCTTTAATAAAGGGCGTTGCAATTCTAATTAATTTTGCAGTATATTAATGTTTGAAACACGGTAGGGATGCACCAG
AAGTCAAACAAAAGTCCAACATTCCGTGGAAATGTTTGTTAATGTATGAAACGAGTAGTTCCACGTAAAAAGTATGATTTTAGAATAAGTTCCTGGCTTA
GACGCATCGTCTGAATGTAAATTTAGGACCTCATTCAATCAAACACTTTCTGCTTTCCTCTCGCTGAATCTATCCTCTTTGGACCATCCCCACTCCTTGT
GCGTACGCACGCCACATAACTGTCGTAGAGTGTACGTCGATGACCAATACATCTGCAACTACAGATTAACTGGTCCAGGATTTATCCAGCCCAGAGGTAA
TCTATGCGGTAAGGTCACCGGGGATGAAAAATAGCTCATAGGTTTGTGCGGTTAGCAGAATCAGCAGGACGGGTATACTTGTTATATATAATCGGCCATA
GGATGATAAAGGGAAAATACGGGTTAGCCGATATATATGAGTCACTATTTTTTCGGCGTATCACATTTTTATCCTTTTACTTATAAGGTGTTTTCACGAG
ACTAAAAGACGTGAAATATTTACGTCTTCCTGCTAACCGTCGATATCTAATTTCTGATTTAGTTTTAAATTAAATCGTTAACTTTTTTTGATTTTTATAG
AAAAATATGATGGGAGTAGGACTCAAAACTAGTATAAATATATGCGAATCATATGTAAAAATGCACGCTTTTATACGTACATCAAACTTCTAAAATTAAT
TATCTGCCTCAAATTATAGCGTAAATGTAAACGATTAAAGTTGTCACATTCTAAGTAAGCTGCACCGCGAACTTGGTTTACAAGAAGTATCTAGCCATAA
TTTTCACTTACTTTCCCGGATTGTAGAGGCTTCTATGCGTCTCTGGAGAGTGCGGAAACATTGCTACTTGCTCATGCGATGAATGATGAATAAATCACAT
CACTAAGTCGTATAAAGAAGTGACGCACCGGTGATACCTAAAAGTTCGGCGACTTTTGTTCTCATGTCTCAGTACAAGAACAAAGAGAGATAATTCAAAG
GACGAGTCGCGGAATCATTGCTTATTTAACGCGGCGTTTCAAGTGTCGATGTACTGGCACCGCCAAAATTGATTTAGGGTCAAACGAACAAGGCAATGCC
CATACTGCTTGATAACAGCAACGTTGCTCTTGTGGCAGTCTGCTGCTAGTGAATACGACGAGCGCACAATTATTAGGAGCAGAAATTTTTCTTCTTGTCC
TGTCGCATTCCTTTTGGAATGATCTGGGTGGGACTGACGCTCTCCAGAATCCATATACTGTCCCGTTTATGTAAGGACGCGGTTGTGGTCGTGATCATGA
TCATGACAAAATATACTGCACAGTCGAATCTATACTGATCTTGTTGCTTAATACGATCTACGTATCAATTTGACACCCCCATCGAATAAACTTCATCGAT
CTCGTTATACCCCTCGACTCTGTTAAGAAGTTTATTTACCCGTACGTTTTGAAACGAGATCAATATTCCATTGAGATCTGTCAAATGAGATGCATCCCGT
CGCACAGAAACTGTAGCTGTCGATTAAGCTACTGTATTTGGATTGAGAGTTGACACTGCATGTGCAAACATTCCGTTGACCTTATCAGTCTAAAGACCGG
AGTACCTACTGAGCCGCCTTTTCGCGGTCATCTGGTTTTACGCCAGCTATAAAGATTATAGTTGGAATCGCAGTTCTAATTCGTATTTGATATTTTAGTA
CTTCGTGCTTTAAATGCTATAGTATCAATTTTTACAACGCACTGTTGATTTATTTAAACATTTTGATCGGGTGTGTATGTATCAAAGGGTGAATGTATAC
CTATAATTCTCCTATATACTATAATATTTAAATCATTACAATGTTAGCGTACGATTATAATAAACCTGTATTAATAAATAACTTGATTAAAGTTAACATC
TCAGATTTGAAGCAAGATTCTAGTGCGTACAATACGTGACAAAACGACGAGATGGCATGCAGGACTGAGCTCGTCGTCTTTGTCGACAGACTGATTGAGA
TGGTGCATTTCGCACCATATCGCACCAGTGTATCAGGCAAGGAGGCAGCATCTTTGTTCCTGGATCACGTGTATCGACTACTGGTGGTGCCTGAGTCCAT
AGTTTCAGACCGGAATCCGCGTTTTACGTCTGGGTTTATGTGCCATGTGTTTGAGCTGCTTGTAGCAAGCTCCACATGTCTACCGCCAATCATCCCCAAA
CCGATGGCCGACCGAACGGGCCAATCGTGATTTGGTGGGTGTATTGCGCACAGTAGTTGTCATTGGCGAGATGGATAATAAAATCGTTAGAGCCTCTCAA
CGCTTTGTGGATGATTTGATTATCCATCACACATAAGTTCCGTGACGCTATGGCAAGTGCAACAGGATAAGCAGAAAAAATATACAGACCAAATTGGTCG
CAGAAACCATGAACTGTTTAGTGTAGAGAACAAAGTACTATCAAGTACTAGAGATCTACCTAAACATACAGTTTTAGTAATACCTAGTGTAATACTAAGC
TATTTCCGCGAATTACTAGGCTTTTTAGCGTGGTTTTTAGAAGTCATATACCTAAATCATAGGCTCACCTTCCCACCATACACGAAGACACACCCCTTTT
TTGTTTACGTGGGTCATATTAAGCGATATGCAAATCTACAAGAGACCGCCTATTCGCATGGGTCTAACGTGAACGATCGCGTAGAGGAAAATGTGGCGAA
CAACTGTACTGCAGAGGTAACGGCGTCGAGGAAACACCTCCAGCCGACGCGTGACCTGCCCATCCTCGAGATTGGTGACCGATGAAAACTTCGCATCAAA
CGCGTGTCTCTTATCGCCAGATGCTCCAGAAGATCGACTCAAACCCTTAATTAACCGGTCGTACCTTGACGTGCCTTCATACGGACGTCGTGCAGTGTCG
AGGTCAGTTGCTAAACTTGACTGTCGAGAGCCACAGTTCGCTTCACGACATCAGCGTCATGCACTTGCGTCTGAATAGTCGACGTGTGAGCCGCAAAAAA
ATACGAGAATATTCAATGTTCGTATTGGGCGTCACATTTAAGGGTGGATACTGAAGGAAACCAACGCTTCCTTATATGAAGATTGATTGCTCACGGGTGA
AGGAAGCAGAAACTTCAGATCCTTGTCTAATGGAAAGGGTACCTGCAAAGCTTTGACTAT