Description :
From Genome Similarity Track
Location :
Scaffold_175:7141- 9404
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_175-fgenesh-gene-0.11Prolyl endopeptidase

Sequence
2263 bases(100 bases per row)
ACTTACTGGGTGAACTTGGCGCCGAGGTTCCACGCGATGAACGCAAACACCTCCGAGTTCTCTTCGATCGTCTTCGCCAGCGGCTTGCCCGCGCCGTGAC
CCGACTTAGTGTCGATGCGGATCAACAGTGGGTTCTTCTGGGATGGCGAGTTGCCCAGCTTGTGCTGCAGTTCCGCAATCAACTTGTACGAGTGCAGTGG
CACGACGCGGTCATCGTGGTCACCAGTCGTGAGCAGCACAGACGGGAAGCCGCCACCACTTTTGAGGCTCTGGATCGCTTCGCTGTCTGCGCTCGGCACG
TTGTGCACTGGCGAGTACTTGAGCAAGTACTGGAAGTCCTCAGCGACATCTGGGTCACCGTAGTCCGATCGCCAGGCGTGACCGATCGTGAACTTGTGGA
AGCGGAGCATGTCCATCACACCAACCGCGCCGACTGCGCAGCGATACAAGTCAGGACGCTGGTTGCTGGTCGCAGCGACCAGGAGACCACCATTCGAGCC
GCCGTGAATCGCGATCTTCGATGGATTCGTGTAGCCTTCCTTGATGAGGTACTCGGCGGCGGCGTGGAAGTCGTCAAACACGTTCTGCTTCTTGAAGAGC
ATACCGTCCTGGTGCCAGTCCTCGCCGTATTCGCCGCCACCGCGAAGGTTTGGAAGAGCGAGCACACCTCCAAAGTGCTGCACAAACACCAAGCGAGCCA
CGCTGAACGCTGGGCTGAGGGAGATGTTGAAGCCTCCGTAGCCGTACAGGTACACTGGCAACTCGCCGTTCAATGGCGAGCTCTTGCTCTTGACGATGAA
CATCGGGATCTTCGTGCCGTCCTTCGATGGGTAGAACACTTGCTTTGACTCGAACAAGCTCGCGTCAAAGCCCTTGACCTTGGTTTCTCGGAAAAGCTCA
CCGTTGGTCTTACCGTTGCTGAGGTCGAAACGCAGGATCGAGCCTGGGTACAGGAACGAAATGAAGTGGATGAAGAACTCCGACTCGGAGCGCTTGGTCG
ACATGCCGACAGTGCCGACAGATGGCAAGTCGATCTCATACTGGAACACGCCGTTCAAGTCGTACACGTGGAGCACGCTCACGACATCCTTGAGCAGCTG
CAAGACAAGGAGATCGCCGGCGACTGGGTTCACACCCTCGAGCACGACCAGATCCTTCTGCTCAGGGATCACTTCTTCCCACACAGCAGCGCCAGCGGTC
GAGGTGTCCACACGCACGACGCGTTCGCGAGGAGCGTCCTTGTTAGTCTGGAAGTAGTACACGTCGCCTTGGTTCAAGATGTACGAGAACGAGGCTTCCA
TGTCGTCGACCAACTTGCGCACGGTGATGAAGTCCTTCGACGGTGACGCCAGGAACTTGTCGAAAGTGGTCAGGTCCGCCAAGTGGACCATGTTCGCGTT
CTTGCAACCGTCGTTCAAAGAAATGATGAGCTTCTTGCCGTCTTCCGACACCTTGGCGGTAATCGAGTACGATGGGTCCGTTGGGTACGCGTACACGAGC
TTGTCCTGCGACTGCGGGGTGTGGAGCGCGTGGTACCAGAGCTGGTGGTTCACGTTGGAATCGGTTTCCGTGCCGCGCTTCGAGTTTTCTTCGTCGTCCT
CAGCCTTGGCAAGGTTCTCCGGTGGTGGGTAGCGCGAGTAGAAGAAACCCTTGTCGTCGTGGGTCCAAGCAATCGCACTGAACTTGACCCACTCGACCGT
GTCTTCAAGTACCTTGTTGTCATCGTGGACAGCGAGCACCTTGATCGTTTGCCAGTCTGAACCGCCGCGCGAGATACCGTGCGCAAAGTACAGCTTGCCG
TCGCCAAGCTTGCTTTCCGAGAACGCGCGGCTCGAGAGCGCAGCAGTGCCGTCGGTCGACAAGAGGTTCGGGTCCAAGAGCACGCGCGGCTCGCTCTCAA
GCGTGTCTTGGATGTAGTACACGTACTGGTTCTGCAGTCCGTCGTTCTTCGCGAACACGTACTTGCCACCGTACTTGACTGGTGCCGTGTACTTTTCGTA
GTTGAAGAGCTCGGTCAAGCGTGCCTTAGTCTCTTCGACGAACGGCACCTGATCGAACACTTGCTGCGTGACCGCGTTCTGCGCGTCGACGAACGCCTTG
GTCTCGTCGCTGTCCGGGTCTTCGAGCCAGCGGTACGGGTCCGCGACCTTCACGCCGTGCAGCTCTTCGGCGAAGTCGCTGCGCTTCACGGCCGGGTACG
CGATTGGAGTGTCGTGCACACCCACCATCTCAGTCTTTCTGGTCTTCTTCTTCTGCTACTTCT