Description :
From Genome Similarity Track
Location :
Scaffold_951:714- 2508
Transcript NameFunction/comments
g17072.t1hypothetical protein

Sequence
1794 bases(100 bases per row)
TTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTG
CAGAGACTCCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGACG
GTCTAACGTGTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCAACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCC
GGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACTCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTCA
CCCGAGTTGTTGACTCCTCGAGTTGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAAAA
GTGGAGCCAGCCGCCTTTGGGTTGAACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACGA
AGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGTGAGC
AGAACCATAGGTAGGCTTTCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTAACTGCATTCACCAGCTTGTAGTCGAT
GCACAACCGAATATCAACTCCATTTTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAATGCCACTAGACGAGCTTTCAGCAAGCCT
TTCAGAAGCTCGTACAGCTTCCGGAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGAGTGGATGCCCCTGTACGTCAATATCGCACACCACGC
CGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCATTTCAGCACCGCAACGAGACGTTCTTGTTGACGGGCTGTCGCGCT
CGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCG
ATCTCATTCGCTAAATGTTCGGACGTATTGGTCTCGGTGTTCCCACCCACTACCTGAACCGTCCCCCGCGGCAATCTCATGCATCATTGCTACGAAGGCA
GAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCG
AGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTCGGTTCCTCAGT
GCCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCT
ACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACT
CCTCATACTTGGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCA