Description :
From Genome Similarity Track
Location :
scaffold_86:71396- 75453
Transcript NameFunction/comments
g3150.t1 serine hydrolase (FSH1)-like protein, putative
g3151.t1 elicitin, putative
g3152.t1 conserved hypothetical protein

Sequence
4057 bases(100 bases per row)
CCTCCTCCGTTTGAGTCCTCCAAGAAGATCCGTGTGCTGTGTTTGCATGGGTTTCGCACCAACAAGGAGGTCATGCTGGATCAGACTCGAGGCCTTCGAG
CGGTGCTGGGGGATTCTGCTGAATTCGTGATACTGAACGGCACGTACGAAGCTCGCGGGACGAGTGATCCAATGATCGAGAGTGCGTACAAGTCCAGTGC
CCCGTTCTACGAGTGGTTCGAGAATCAGCTGGCTGACGGATCTCCGCTACTGTACAACGACGCCGAATCGTCCGCCAAGGCGCGTCTTCTAAGTGGCGCC
GACAAAGGAGAAGACCACGCGTGGAGTTTGTCCTACAAGGGCGTCGAGCAGTCGATGATAAGGATCGACGAGGAACTTCGTCGTCATGGCCCGTTCGACG
TTGTCATTGGGTTTTCCCAGGGTGCAGCGCTGCTGACAATCCTGACGATGTGGTACCTGCGCCACGGGAACGTGCGTTGGTGGAAGCTGGTGATCTGCGT
TGGTGGTGTGGATGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTGGATAAATCGGGCAACCGCATTCTCGTGCCTCTGCCTTCGATCCACCTTATTGGC
AAGACGGACCCGCTCTACCATGAGTCGCATCGCTTGGCATTGTCGTGGACAGACAAAGCGGAACCGAATGATTTCAAGAAGCGGATCTACGTGCATGGCG
GCGGGCACAAATTCCCTTCCGTTTCGAAGAACCGTGGGTTCTACGCGGAGTTGGGCCAAGTCATCAAACAACACTGCAACAAAGATTTGGAAACATCGAC
AGCTAGACTGTAAGTGCACACACAGCACATTCCTAAGCGTTTAAACAAAGAAATCTGTCATCGATTGCTAAAGTGGGGGAAAAAGTTTTCATTTCACTTT
TCATCGAATGCACTCATTTCGAGGCCAAACTAAAAGAAAACAGCACTTTTCAATTGTCCAAGCAGCCAAGCAGAACCCGCAACTGTATAATGCTTGAGCA
AGCAAAACTAAAGAATCTCATGTCAAAACGGAACTTCATTCTTGAGTTCATTTACTACGAGCTGTTTGTCGGCGTCACTATCGCTGCGCATGGTAGTAAT
GTAGCGAGCTTTGTCGCTTAAGCCGAGAGGCCGAGAGCCGTGCAGTTCGGCTGGAAGCTCTCCGCCAGCTGCAGCACGTTGATCGACACGGTGCCAAAGT
TGATCACGCAGTCCGATGGCTTGAGGGCCAGGAGGTCGTCAATGAGCGAGTAGCAGTCCGAGGTCAGACACATGAGCAGGACCTGGGTCTCCGTCGGATA
GGCTGACGGCGGCACGAACGTGTAGCCCGAAGCGGTCTGGCACGAGTCGAGGTACGGGTCAGTGGCAAGTGCCAGCAGCTTGGCGGTCTCCGAGGAGGGG
CAAATGGTGGTCTCGTCATAAGCAGCAGTCTGCGTGGCAAGGCAGGCGACGGCGGCGGCGGCGGCGTAGGTGAAGGTCTTCATGGTGTTGGAAGAGGAGG
GAGTGAGGAAGCTGGTGTTGGAGCTTGGTGGAAGATTGGATAATGAGCTTCAGGTGGAGCCTCGAGAGCGAATGCCTCGTGCTTCGGTCACCGAATCGGT
GAGTACAAGGACAGAAAAGCTCTCGTCAAACGGCGAATGTGACCGACGTTGTTCAACAACTTGTTGTGTCCCCAGCCAGCGGGAAGTTGGAAGCCACAGC
AGCAACGGAAAAAGGCTATGAAAGCACACTTCAACAAGGATAGCGTTCATAGAGACTTGCTCTGGTGACTTGCATTCCTGGTCCGACCCAAAGCGATCTG
TTGGCAACAACAGTGTTGCCGGTCGACTTGACTGTTCTGGTGACTGCCGTGGAACGATGTAAAGCTCGGTGTGAGCTTGCTGACCATGCAGAAGCGGACA
ACTTCAACGTGTTTTACCTGATCCGAGCTCACGTTAGGCTGAGACCGTACAACGGACTCCGTTCAATGAACGGAGACTTCCAAGAGTATCGTTTCAGCGG
ATACCACATAACATGCCAATGGAAATATCGTCTTTGCCGCTGGAACCTAACTTGTTGCCTCCTAAAGTGACGGGAGTTCATGAACACTGCGATTTATACT
CGATTCACTTTATCGCTTACAAGTTTACAATTTATCTTTTCCGACACTATCTCTGAGTCAGACTGGGCTTTCCACGATGGCTTGTGTAATACCGGTACGG
TAGACCACCCGTGACCAGGATGTGTGCCTCGGAACATCAGTGAGTAAAGGTCCTTATCCTAGAGCTTCTAGACTACCGGTAGAAGCTTTTGCCATCACGT
CAACGTCGCGCATGCTGGTGTTCGACTGTCGTGCGGGAAAAGCTGTTCGTGTGTTGAAGTGCTACAAGGCTGATAGACAGCCAGCAGTCACTGCAAAGCT
GTGTGCATTGCAATTTGCATACAACTACAGCACTGCTGTAACAGCAGTGTACTTGGCCCGGTTTGACTTCCGAATTCCTTGGCAAATTCCAAGATCTCAA
GTTGAAGTTTCATTGTGTGTCGCTTATGTATACCCTTACTTCGTATTTTTAATATTAAGTTTATTTTTATCAATATTAATTTTCATTTTATCTTTTGGTT
TAATTAAACACCACTAGGTAATAATAAATTTAAAAAAATCAATTTATGTTTTTTAATTCCAATTAAATTAAAACCTAAATATACTAATTCCGGTCTCAAT
TGCGATCTTCCTGCATTATGCTTGTCCATCTCGAGCTGATCGTGCTGCTTTATCTGGTCCTGCCACGCTTGTCTTCACCAAATACCACTGGAACTCGTCA
AGTTCAATGGCCGCAAGCGCCTTCTGGTGGCTCCACAACGATGTCGGCTTGTGAGTTCACTCACTTGCACCCTCGTCGATACGGGGCCTATCACCTTCCT
CCGTTCTCGTCCAGCATCACCATCGACGGCGTTCTGGACGAGAAAGTGTGGACCGAAGTGCCATGGAGCGAGTCGTTCCAAGACATTCGCGGCCCGACGT
TCTGGTCGCAGCCGTGGTTCAGCACAAAGTTCAAATTGCGGTACGACCAGCAGTTCCTCTACATCGGCGCTTATATCGAGGAGACCGAGGTGTGGGCCAA
TGTCTCACAGCGCAACGAGGTCATTTTCCATGACAACGACTTTGAGGTATTCGTAGATGCCGACGGGAGCACTCACAACTACAAAGAGTTCGAGCTGAAC
GCTCGCAACGCCACTTGGAACCTGTGGTTAAACCGGCCGTACAGAAATGGCGGACACGAGAACAGCACTCGAGTGGACCCGCAACATGGCTTCGATATGT
TGAACGGTGGCATGCGGTCAGCGGTTTTTGTCCGGGGGCCGATCAATGATCCATGTACGTTGAAATAACTGTGAAGCACTTTGCCTTTCCCAGCTAATTA
ATCGTTTTGATTATGCTTTGCAGCCGAACGTCTACACTACTGGACTGCGGAAATTGCACTGCCATTGTCGGAGCTTGCACTGCATTCAACAGCACAAGTC
CCACCAAAGCCCAATTCATTTTGGAGGATCAATTTCTCACGTGTGGAGTGGCCAGTTCGTGTCATAACGGATGAATCTACTGGCAAGCAGCACTACGAGA
AGAAAGCTGGCTTGAGGGAGGAGAATTGGGTCTGGAGTGCACAATATACGGTGGATATGCATCAGCCAGAGTGGTGGGGGTATCTTCAGTTTCGGCCGCA
AGGGGAAACCCCGCCGGAGTTGATCGATGCTGACGAAGTGGTGCCTTTTGATCCTGCTTGGGGAGTACGATATGTGAGTTTTCAGTTTTACTACGCGCAG
CATGCATTCCACAATGCAACGGGGAAGTACACAGCAAGTTTGGAGCAATTACTCCCTTACTTCACCAATCGCGAAGCTATTCAGTGTACCAAGCTACTTG
AAATGAGCACCACCGACAAAACGTTTAGTGCTGAGATTGGACTCCGTGCAGTTCCTTTTGACGATGAATCGCAGTTTATAGCAAGCATCGAGGAAGACGG
ATACATTTCAGTGGAGAAGGTGCGTCATGGATCTGAGGCCACTGCAATCCAATGAGT