Description :
From Genome Similarity Track
Location :
Scaffold_602:7139- 8575
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_602-abinit-gene-0.30Myosin

Sequence
1436 bases(100 bases per row)
TTCTCAACAAGTCCCAAGTAGCTCACTTGCTCCTTGATGATCTCTTCGTTGGCCACGAGCGGCGCCTTCTGCTCGTTCGGCTTGATGCACCGAATGTAGT
GCGGGTTGCAGCCTTCGAGCTTCTTGAGCATGGACTGCACCTGGGCGCGGAACTGCTGCGACGTGGACGGCGGGCGCTTCTTCTTTTCTTCGTCCGTGCG
CTTGTCGTGGAAGACCTCGCGCACAAATGGCACCGTGGACTCGCCCATGTTCTTGTACATGTCGTTAAAGAACGTGTCGACATTGGCCTCGAAAAACAGC
GACACGTCGTACTCGACCTTTCCGGCATAGTGCATGATGGTGAAGTGCGGGCCTTGGATGCGCGAGCGAATGTAGTGCTTGTGGCCACTGTGGGACGCAT
TGTAGCGCTCAATGAGCTCCAAGATCGAGAGCCGCGCGATGGCACACTGCTCGTCAAGGAGCGGGAAAATGCCGTGGATCTTGGGGTCTTCAATCAGGTC
GCACACGCTCTGGTTGTTGAGGTACTCGACGGCCTCCCAGCTCACGGCCTCGCGCTTGTACTCGTCCTGCTCGGCGCGCAGCGTCTGCGCGATGAAGAGC
TGCTGGAGCTTTTCGTTGACGTAGTTGATGCAGAGCTGCTCAAAGGCATTGACCTCGAAGATCTCAAAGCCGTAGATATCAAGAATGCCAATGCTGCTCG
CGACTTCGCGCTGGTTGCACAGCACGTTCTTGTTGATGCGCGCGACGATCCAGTTGAAAATGTTGTCGTACATGGACCGCGCGATCGAGTCGACGACCTT
CTTGGCCTGGCGCGAGTCGAACTGGACCTTTTGCCACTCGCCGTAGATGTTGAGCATGCGGAACGTGACCATCTCTTCGAGCACGGCCGTCTCGATGCCC
AGCAGGCGCGCGGCCGTCTCGAGCGCCTCGCGGCTCGCGTCGTCCACCTTGGCGCACTTGTTGTGGGCCTCGTCCGTGGTCTCGATGAACCGCACGTTGC
CGATCCAGAGCACGGCCGCGAGTTGCTGCAGGATGGCGCTCTGCTCGTCCTCGGCAATGCCCACGGCCGTCATGTTTTCGCGCACGACGGCAAAGTTGGC
GCCGTCGTCGACGCCCTCAATCTTGGCGTCCGTGTTGCTCAGAAAGTCATAGTCCTCGGCGGCCAGCAGGTTCCACTGGAGCCGCTCGTCGTCGCTCGCG
CCGGCCAGCAGTTGGTAGAACGAGTGGAAGTTGCGCTCGCCCTCGGCCTGGTGGATGATGCGGCTGCGCTCGAGCAGGTAGTTGTCAATGTAGCCGCCAA
TGACCTGCCCGAGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGCGGATGGTCTGGGCATTGCCAAAGGCCTC
GAGCACGGGGTTGGAGCCCCAGAGCACGTCCGTGAC