Description :
From Genome Similarity Track
Location :
Scaffold_141:71387- 73244
Transcript NameFunction/comments
Hyaar_Emoy2810924pol protein

Sequence
1857 bases(100 bases per row)
CCATTGACAAACTTGCTGAAGAATGACGTGATATGGTCACGGTCGGGAGAGGCCCAACAGGATTTTGAAGCCATCAAGTTGAGCCTACAATCAGCACCAA
TGTTGGCGTTACCGGACGAGGATCGTTCGTTTAGTGTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGCTGCTTCAGCTGGATGCCAAGGGCAA
CGAACGTATGATTTCGTTCCAGTCGCGGCAGCTCAAGGCCGACGAGAAGAATTACCCAGTGCATGATAAGGAACTTCTTGCGATGAAGTATGTACTGGTC
AAGTTTCGGGTTCATCTGCTAGGCAGTAAACCCTTCGTTGTCTATACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTGTCGCAGCACA
TGGCGCGTTGGTTGTCATTCTTTGCGGAATACAACTTCACGGTGGCTTATAAGCCAGGGAAGCAAAATGTGCTAGCTGACGCGTTGTCAAGGCGTCCTGA
TTATGAGCTGGCACATGTGGTGCACCTTGAACCGACACTTTTTGAGCTCATACGTGGGGCGTATTCTCAAGATCCGGACTTTCGAGGTGTTATTGAGGCG
CTGGGCACCTGACCGAACATCGTCAAGTTGACGAAACGCTAGCAGGCACATCTCCATCGGTATAGCCTGTTCAATGGACTTCTGCTCTACAGTGTGAATC
CTGTGGATGAAAAGCGAGTAGTCGTTCCAAACGACGAAGATTTACGCCACCGGATCCTCTACGAGGCACACGATACGCCTGGCAGTGGTCACTTGGGGCG
CGAGAAAACGTATACGTCTGTAGCACGTGAATTTTGGTGGCCCTACAAGTACAAATGGGTGCGGTCTTACGTTAAGACTTGTGAGACTTGTCAGCGGGTG
AAGCCCCTACCGTCCTTAGCAGCGCCGTTGCAGAGTTTGCCAGTCCCGGAGGACTGTTGGCGCTCAGTGAGAATGGACTTCATCCCTTTGATCTACCGGC
AGATAGACATGGCCATACTGGGATTATGGTTTTCGTGTGCCGCCTCAGCAATATGGTGCGATTAGTGGCGGTTCGCCGAAGTGTTACGGCGCCGCAGGCG
GCCCAACTCTTCATTGATCATGTGTTTCGACATCATGGACTCCCGGAGTCTTTTGTGAGTGATCGGGATCCTCGTTTCGTTTCGGCCTTCTGGCAGCATC
TCTTCCGGCTGATGGGGACTCGACTGGATATGTCGACAGCGGATCATCCGCAGACAGATGGTCAGACCGAACGGATCAACCGTGTTTTGGAAGATGTGCT
TCGCAGTGTTTGTGTGGATGAGCCATCTCAGTGGAGCGCTCAACTCGCGCAAGTGGAATTCGCGTTGAATAATGCAGTGCACTCTTCTACGGGTTTTTCC
CCGTTCTATGTGAATGGGTTGCGGCATTCGCTTCCTCCCCTATCGTTGCCGAGGGCCTCTGATTTGGAGGGGGGGAGAGGCTGTCGCCGATGACCTAAGA
AGTTTAAGTGGTGTTCGACCATCGGTCAAGCGTAATTTGCTTACGTTTATTGAGACTGATGAAGCCATTCGGCTCCGCGTAAGGGACGCCATGGCTGCCG
CTCAGGACCTTCAAAAGGAAAACAGTGACTGCCATGGGCGTCGGAACACACAGGTGTTTAAGATTGGTGATTTGGTGTTGCTAAATTCTCGCAATTTACC
TATACACGCAGTGTCGGCTGTAGGGAGTACAAAGCTTCGTCCGCGCTTCGTGGGTCCGTTCATGGTCATTGGTGTGCATGACAATGCTTACACTTTGAAC
TTGCCATCGGCTATGGCAACGCATCCAACGTTCTACGTTGGGATGCTTAAGGCCTAC