Description :
From Genome Similarity Track
Location :
Scaffold_1:71374- 75907
Transcript NameFunction/comments
g21.t1XP_009515383.1 pyruvate dehydrogenase E1 alpha subunit [Phytophthora sojae
g22.t1XP_009515384.1 hypothetical protein PHYSODRAFT_554387 [Phytophthora sojae

Sequence
4533 bases(100 bases per row)
AAGCCTTCATCCATCATCTCGCAGGCGCCCCGATATGAGTGCCGCCCAGTCAATTAATGCACTGCACATTGTGGATGATTTGACCCAATCGGATGGGTGA
CGTCAGGAGGGGGATTTCGTACTTTGCAGGACACCCGCGCGGTTTTTGCGGCGGACGCTGGTCCAAGCAGCGTCCGAGCCGTCCACTCCTCAATCCTCCA
AGCAGAAAGGAAGCGCTTCCGTACTCTCGAGATGATGATGCTCCGCCGCTCCACCGCCGCGCTGGCCCGCGCCGCCGCGCCCGCCTCGCGCGCCTTCAGC
GCCGCCTCGGGCGAGGTCAAGTTCGACTTCGCCCAGCCTTTCGAGCTGCACCGTCTCGAGGAAGGCCCCGCCGATTTCGCCGTGACGACCCGCGAGGAGA
TGCTGAGCTACTACAAGCTCATGTACACGATGCGCCGCATGGAGATCACGAACGACAACGAGTACAAGGCGCGTACCATCCGCGGCTTCTGCCACCTGTA
CGACGGTCAGGAGGCCGTGGCCACGGGCGTCGAGGCCGCGCTCGAGCGCACGGACTCGTGGATCACGTCGTACCGTAACCACTGCATCATGCTCGCGCGT
GGCGCCCAGGTCAAGGACGTGCTCGCCGAGCTCTTCGGCAGGGGGGAAGGCGCCACGGGCGGCAAGGGTGGCTCCATGCACTTCTACAACAAGAAGGCCA
ACTTCTACGGCGGCCAGGGCATCGTCGGCGCCCAAGTGCCTGTGGGCACGGGTCTGGGTTTTGCCAGCAAGTACAACCACAACGGCGAGGGCCTCATGCC
CTGCGCCATCACCATGTTCGGCGACGGCGCGTCCAACCAGGGTCAGGTGTTCGAGGCCTCCAACATGGCTGCGCTCTGGAAGCTGCCCGTGATTTTCTGC
ATTGAGAACAACCACTACGGCATGGGCACGTCCTCCAAGCGCTCGTCGCACAACGACGAGTACTACACCATGGGCAACAAGATCCCCGGCATCAAGTGCG
ACGGCAACGACGTGCTCGCCGTGCGCGAGTGCACCAAGTTCCTCAAGCAGTGGTGCGGCGAGGGCAAGGGCCCCATCTTCGTCGAGATGAACACGTATCG
CTACCACGGCCACTCCATGTCGGACCCCGGCGTGACGTACCGTAACCGTGACGAGATCTCGCAGATGCGTGCGTCGCGCGACCCCATTGAGCTCGTTAAG
AAGCGCATGATCGAGTCGGAGCTCGCGACTGCCGACGAGATCAAGGACCTGGAGAAGAAGGTGCGCGCCGAGGTCGTCAAGGCCACCAAGGAGGCCAAGG
CCTCGAGCAAGCCCGAGGAGTCGGAGGCTTTCGAGGGTGTGTACGCGGACGACAAGGGCAACAACGTGTACCCGCCCTTCATCCGTTTCCCCGACTACGC
CAAGAGCCTGTACAACGGCAAGCGCCAGTAAGCGCTCAGCGGTGGAGACCACGAAGCGGCGAGAGGACCCCCCGCCCCTCTTCAGGACCAAGCGCCTCGA
CAAGCGGTAGAAGCTGCGCTGCGTCGCCTCGTGTTTCCTCGCTTGATTTTCGGCTCGCTGCTGGCATGGCGTCGAGTGCTCTGCTGGCATCGAAGCTTAG
CTCTAGGACATTAATCCGGCTGAATATGTAAACGCGGAACGCGACCACATTTGCCTCGTACACTTTGACTTGCGTGCGTCCGCGTGATGCAATCGGCTCC
TGCATGCCGATCCCACATCTTCTTCCAACGTTGGGTGGTGTTGCTGCATAGCTCTGCCGAGCGCGTGGTGGTGGGTATCTCCGTCTCCACAGTGTGGAGC
GTGTGGAGTCCACACGCGTCGGAAACAGAACCACCGTCGTTGTTGGTCACAGCATCGCGAAGATGCAAATCCTGCCAGGCAAGACGGACATAGACCGCTG
TGTCGAGTGCGTTGCACCCGTCAAACCGTGTTGCCTTTGACACCAAGCAGAAAAAATGATGTGCATCAATTTCGCCGCCATCCACCACTCGACACAGGCA
CATTGGAAGAAGCTGCTCAATTCCCATGTTGAAGCGTTTACGATACTATAATGCAAGGTCACTCTGGCCGTGGCCGTCCACGTGCACATGCTTCTCCTCC
ACCTACGGCCGCGCATATTTTTCTACACTACATGTACTTCACCACTAACTATATAGTTCACGGTCGGCCGCGTGGTGCGTCTTGATACTTGCGTCGCCGT
CGTCATATTTCCCCGAACGGCTGAAGCGAATGGCGTCTTAGTTGGAATACAGCACGGCTCCAGCCGCTTCCAAGTCGCTGCCGTGACGGCGGTGACGGGG
TCGACGACGCACAATCGGACCATTCCTGTTGCTGCTGCTGCTCGTATTGACGCCTCCATTTCGGAGCATGGGGGCCATGAACACGTGCTCCTGCTGCAGT
GCCACGACGCGGAAGTGCGAGAGCGAGCGGGCTTGCTGCGCCAAACTGTTGGCGTAGTTGGCTGCCACGATGATGTTGTTAGCGCGCGCCATGGCCTCGT
TGAACTCGAACTTGTCGCTATCGTCTTCCGTCGATAGCTCTTGGTTGTTCTCGCATGCGAGTTGAATGCGCGAACGCCCCTCTACAGGCAAAGGCCTCAC
GATCGAGTACGTGGGTGACGTGGAGGAGGACGACGTCGAGGATTCATCGTCAGTATTGTCGTTGTCGTCCGATCCGTCCTCGGGCTGACGCTCGGCGTTG
CCCATGCGCATTTGGTGCAGACGGAAGGCCTCGAGCGAGATGGCCAAGTCGGCCGGACTGCCACGGCGCTTGGCTGCGAACAGCGCCTTGTTGCGCATGA
CGAGGCCGTCGCTGAAGGAGCGGCTCGGGAAGCTGGCCTTGGGCACTCCAATGGCCGAGCCAGTCGTGCTGTGGCCCTCGTCGTTTCCTGACGAGAAAGT
CTTGTACTCGATGAGGCGGGAGCGCACGGGGTCGAGCAGGTTGTCGTACGACCGGCGCTTAGGAGGTTGCTGCTTCGGTTCACCGCTGGCGACTGAGAAG
CTCTGTGCACGGCCGAGCACTCGGGTGCTCTCGTTCGTGTCGGCGAAGAACTGATTCGAGCCCGTGGTGCTGCTGAACGACGGGGTGGACGGGGGTTCCA
TGCCGCTGGCTGTGTTGCGCGACGACCGACGGGCTTCAATGACGCACGCCGTGCAGACGCGTAGCTGCCGCTCGCCAATTTCAGGCACGTGTGCGCTGCG
TACAGAGCTGCACGAGCTGCAGCAGACTTCGCCGCACTTGAGGCAGTTGTAGCGGCGGCGACGCACACAGAACTTCTTGGAGCAGATGCGGCAGTGATCC
AGCTCGCTCATGGGGATCACTTGCTGCGGGAGCACGATCTCCTCGCGGCCCACGCGGAAGCTCTCGGTGTACTTGAGGATGCCGTTGATGCACTTCTCCA
CGTGCGACTGAATGGCCGAGTTGGCGACCCACGCCGGGAGGTCTCCGTTCTTGTCGAACGTGCACGTGTACGTCATGCGTAGCTCGCCCGACCTCTTGGT
CGAGTGATACATGAAGCCCATGAGCGGCACGAGGTCGCGCGTGTACTTGGGCGACTCGGCGTACTTGGAGAACCCGGCGGGTGTGTCCACGGACTCCATG
ATGCGAAAGGCGATCATCTGACCCTGTGCGTCTTCGATCATGTCGACGTACTCGAGCATGAGCAGGTCCCGGTCCTTGGCGAACGGGCCCGAGCTCTTGA
ACGCGGCCCACTTGAGAGCGACGTAGCGGTGCGGGTTGGCCGCCGTCGGCTCCACGATGTTCTGCACCACTGCGCCGTCCAGGAAGTCCGACGACAGCAT
GGCCATCATCCGCTTGAACGACGCCGTCGTCGGCGTGATGAGGGACGCTGCTACGTCTTCGATGTCGCACGCGAACTTGCACACGGCGTGCACGTTGCAC
GGCACGTTGGTGGCGGCGTTGGTGGCGTCAGCGCGGAAGAGCGAGATGCCGTGCTTTTCGTGCACGAGCGACCAGGGGATGCCACCGAGCAGGTCGGTGG
CTTCCAGGAGGCTCTCGGTCATGCGCTTGGCCACCGTCGTGAGGCGTTCGCGCTCCTTGACGCACATTTCTGAGCTCTCATCGGCGTCGCTGTCGTCGGA
TCCGTTCGACGAGCCGAAGCTGGAGAGCGAGCGAGGCGTCAACGGGGTCCCGGTCAGCGGGGATCCGGTGCTGGAGCTGTAGTCTGTCATGGCAAATGGA
CTCAAAGGGCGAAGGAGGAGGCGTCGCGCATGAACTCGAAAGCTCAAATGCGAAACTGAGCCCGAGCGTTCTCGTCGCACGTAACAGCCCCCACGCAAAG
CCCTATTTAGCGCGAACGGCTAGCCGCTTCTCTTCTATTTTATGGCTGACGTACCCGGCAGGAGGCCGGAAGTGGTGAGATGAATATCTGCCGACGAAAT
CCATCGCCAATGCTGCGTGAGCAGGTTTCGTGTTCATGCGGGCGAACACCTCGCCCCTCGTTCGAGACAGCCCATGACGACCATGGCCGAGAGGTGATTT
CGAGCGGGGGAAGCTGGACGCCCGTCAACTCGA