Description :
From Genome Similarity Track
Location :
Scaffold_44:71354- 73406
Transcript NameFunction/comments
Physo_136210reverse transcriptase
Physo_136211hypothetical protein

Sequence
2052 bases(100 bases per row)
AAAATCGCAGTCGGAGTCCGGTAGCTAGGACGCTCGACCAGCGGTCCAGACTCTTCAACTTCCGCTTCGTTTGCATCTCCAGTGTCCACAGCTGCTTCGA
ACGCAAGTGTTTGCCACTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGACGCGGGATCTGCCCAACGGGTAACCAGATTGCCAAACACAC
CAAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTACGACTTGTTACTGAATCAACCATTCACCACCGTGATCACCCATTTTCCC
CCTCTCGTTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACTTCATGGAATCCCGTTGCGTAGACCG
CGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATCTCGATGCGAACTTCGTCCGGCAGACAGAGCGCTCCGTCAGCCAGGTCCAACCTCAACCC
CGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACACACGGAACTTGTACACCAACTCTCCAGCCAGAGTGAGC
TTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCAGACCAACACATTCCATTGTCTGTGTTGTATCAATTTCACAACCCACCTTACGTGCAA
AGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCACAGAGTAGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGCTTGAACCACTT
GGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACGCGAATAGTCACCTTCATCCGAGGTAAGAGGTCTGGC
TGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTCGATCGCTCGTCACGTACCAGG
CTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGACAGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGGCGAACAGCATC
GAAGAAGTCGCCGATCTTACACTGACCTGCTTCGTGAACGTCTCCACAGCACTTGCACACTTGTCGGTAGGATGGCCCATGTGTCCCCACTTCTGGCACG
TGAGCCTCTTCCAGCACCCGAGATCCGTATGCTTGCGAGATCCGCAGTGTGAGCATCGAGTGCCGTACTTCGGGCGCCCCAGTTGGTCTTCGCGGTCTTG
GCGCGCCCCTGGCTGTTCACCATCTCCTGGTGTAGGCGTCCTAGCTGCCGAAAACACGTGCGCTCTTTCGTCTTCAGATTCGCTATCGGAACTGCTTGAT
TCGCCCTCAAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCGCGACCGGTAGTCACAACCCGCACCGCCCTCGAGGAGGCTGCAGGGGCGGGAGCCT
TTTGGCGGTATTTCGAACCTTGGGTCTCAATATTGCGACGTTGGTGGCGGCGTCGCATGGCCAACAGGACGCCTTCGAGAGCTTCTGAGTCAGGCAGCCT
CAACACTACCAGATATCCGGCGAGATCGTCATCTTGGACTGTATCGATGTAGTGGTCGACGTGTTCACGTCGTTGTTCCTTGTTGCCATCATGGATCTTC
AAGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATAAGTAATCCAGTGGGTCTTCCTGACTCCCTTGCCGCATGTGGTAGTACTTGCGCGCGAGGGAGA
TCCCTTTACCGCAAAAGTGGATCTAGAACTGTTCACCCAGGTCAGTCCACGACGCGCGAGCGGTGCGGCTCAGCTGGTAATACCAAATACGCGCAGGGCC
TATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAAGGCCGTTCTAACCTTGTTGAACCAGGCTCGGGCGGCCTCT
TCGTCATGTTCCTTGCCGCTGAAGTCCTTCAGTTCGGACACAGCCGACGCTC