Description :
From Genome Similarity Track
Location :
Scaffold_60:71354- 73330
Transcript NameFunction/comments
Phyci_81730conserved hypothetical protein
Phyci_191332Hypothetical protein

Sequence
1976 bases(100 bases per row)
AGAGCAGTTCGCGTGCACAATCTGCCGTGCTCCATTCCGCAATGCCGTGGAAACGATGTAGGTGGACTGAAGAGAACCAATCTAGTTTTGGAGATGTGTA
TAATGGCGAAAATGTATTCGCCTTGGCTGATGGCACTAACTATACCTTGTGTGCGCTCCATACAGTTGTGGCCATTTCTTCTGCGAAGCGTGTGCATTGA
AGCACTTCAAGAAGACGTCGCGGTGCTTTAACTGCAAGAAGCAGACCAACGGTGCGTAGTACTGCAGCGCATAAGTGATGCTGCTGTGTTGCCAATTCCA
CTGACTGTATGTATATGTGGCTACTTGTTGCACGCAGGCGTCTTCAACGCCGCGAAGAAGCTGCGAGCGAAGGAGCGAGCGCAGCGTGATGAGGAAGCAA
ACAGGAAGGATGGCAGGTCTATCGCGTCGACCGATAATGCAGATGCACCAATAGGGACACAGGACAATGACGAGGGTGGCGAAGCAGGTGGAGGGTGGAC
CAAGGTCGCGGAGTCGTCGTAGCGGTCTCGGCCTCACCCTAGAAACCAAATACCGGTACTGGAAATACGCAACAGAATGAGAGATGAAGAAGATGCTGAA
GTGTCTTCGAGACCATTACATTTATATCGTTCGCTCCTTGGCGCTTACTACATGTACTTTATTAACCCTTCTTTCCCATATCCTCCGCCACCAATAAATA
CTCCTCTGCTCGACTCGCTGCACGTGCGCAGCGTAGCCGGCCCCCTATCTCCTAACTCAATAGCCGCCTGCACTCTCCAGTATCGACTTGGCGTACGGGT
GGAATACGATCCACCCGACGAGGAACGGATTCATCAGCTCCATGATGCCATTGTTCCAGACCGTGAACGTGGTGCGGTTCCACGGAGGAGCCAAGGCGGT
CTCGTGGATCAACGTCATGAACGAGCGCCCCAACTGCGACAGCGCCGCCGCGCCAACAAGCGTGACGATGTTCCACGTGTTCATACTCGTAGTGACGATC
CATAACATCCACGCCAGCATGCCGGCGGCGCCAAACAGCACCGACGTGATAAAGTCTGCTGCTCTCGACGCCCTCCAGCGCCGGAAGCACCGGACTCTCT
GCTGCTGCGTCGTCACCACGTCGAAGAGGAAGTGTCCCAGCTCGGCCGACGCGACCGTGACGAAAAAGGCAGCGAACTCGCGCGGGAGGTTGCTCGCCAG
CGGGTGCTCCACGAAGTCCACCACTTCCACCAGAATGACCGTCACATGGACCATCGCGATCGTGTCCAGCGTGACCATGAGGAAGCACTCGAGCACCTTC
TTGGTCATTACGACGCGGGATATCACGATCATGGTCCATCCGCCCAGCGCCACGAACAGATAGTCCAGAATCGCTATTTGTGTCTCCGACCCCGTATAGT
GCGCGATCATGGTGCTCATGGCGGTGACGGTGAGTGTGCCCTCGTGGATGAAGATGGCTACGCCGTCGCTGGGTGTAGGAGCGAAGCAGGCAGAGGCTAC
CGCGACAAATGTGCCCACCGCGGCACTCGTGACGACGGTACTCTCTACATATATGGCGACGACGGTGCTCACGGCGGCAGCTGCTGACGCTGCGACCAAG
GCCACGGTGACCTGAGCGCCGCGGACGCCCTTCATCCACCTGTCTGTGAATCTTGCTATCGCGTAGTTCTTGGGCTCCATTCTCTCGAGCAGTTCGCGTT
CATATTGAGCCCGGTCCGTACGCGGTCGCTCCAAATCTCCTCCACCAAATACTACCGCGACTGCGGCCTCTAACGGGGCCAGGAAGCGCTGTCGGATGCG
GAAGTGCCACCAGCTCTTCTCCAGAAGAGCGATACCTTGGCAAACCTGCAGCAGGTACACGGACCAGCGCGAGTGGCCCACGAGAATAGAGAAGAAAATG
AAGGAGAGCAGCAGCGTCGACGCCGCGAGGGTGGCGAGGAGCACGACGAACGTCCCCTTAGCCGAGATGGTCTTGG