Description :
From Genome Similarity Track
Location :
Scaffold_58:71340- 73121
Sequence
1781 bases(100 bases per row)
TTCTTCTATCCTGATGGTGACTCTCAGGAGTTCACTCCAAGCAGTCACTCGGGCGTATCGTTGTCAAGTCAGTCTACGGTAATTGACCTCGCACAAGATG
ATGTGGAAGAGCAGAAGGAAGAAACTACACACGCGATTCCGGCCGACATCACTCATGCACCTCAGCAAAGTGCAACGGATCTCGTGTGGCAAATGATACA
TCGTCTTGGGGCTCCAGTCCTGTACAAAGGCAAGCAACTGACTCACATTTGCATGCTTTGTCTGAAGACGAAACCTTGGAAACAGTCACTGGGTAaggcc
agcaacgccagTAATGCGAATACGCACTTGATATCAGCCCACAAAGATCACGAAATGGCCGTCAaggagcaacagcatcggCTGAGACGGGCGGACCGCT
ACACCGTGGATGTTGAGACCAAGAAAGGAACCAAATGCCAGGACGCTAATGAACCCGGGATATGTGAGGGACAATCAGTCAAGCGCCAAAAAACCTGGTG
GCAACCGAGAGTCAGCCAGGTTCAAATAACGGGGCACATTGCGCGGTGGCTCATTCGGGACGGTGAGTTGCAGCCTATGCATTACCCTACTTGTGTTGAT
ATACTTCTACTTATCGAGCTGTGATATATTCAGGTCTTCCATACAACATGGTGACAACGGCAGCCTTCCGCGACCTTCTTGTCGGCCTCACCGGTCAATC
TGATGCTACTGTTCCATCTAGCAAGACATACAACGATATTTTGGACAACCAGTACGAATCGTTTGAGAAGGATACAGCGGCGTTACTTGCCGAAGAGTTC
CATGAGCTGCACTACACCCCATTTATGACTGTAGAGCACGATATTTGGATAAACAGCTCGAAGTACTGTATCGTAGGTGCGTCATGCGGATTCACTGACC
GCCACTGGCAACCACGGCATCTAGCACTTCTTGCTGAAACTAAAAATGACGGGCATGACTCAGAAGAAGTAGCAGCGTTATTGGATGACAAGCTGAAGGC
TCGATATGGATTAGATGTGGCGAAAATGGCGCGGTTTACCATCTCAGACACAGCGGCTGCCGCGCGGAAAGTATCGAGGCAGTTCGACACAACTTTGCAA
ACGGACTGTACGATGCACGCGTTAAACCTTTGCATCGGGTACGGCATTGGATTGAAGGAAAACGTAAAAAATGATTTCGTCAAGGACCCAAAGACACAAT
CATACATCAAGAAGATGATTGTTGTCACCAAAGATGGAGCGTTCCCGGAAGGTGGTGTGGTTATCCGAAAATTGCGAGCTCTGAACAACTTCTTCGCTTC
GAGCAGGTCTCCGGAACGTATTTCTCGCCTCGCTGAAGTCCAGAGTTTTCTGAAGCTGCCAAAGCTCGCAGCTTTGATGTTCGAGTGGTGTCTACAGTTA
AGTTGTTTCAGCGATCTATTATCAACTATCCGGCATTTAAGGCGTTCTTTCAAAATGCAGATGTTACGAAGAACGGAAAAGAAGTATTCGACTGTATCAC
CGATGGTGAGTGGGCGTTAGTCGTGCAGATGGAGGCAATCATACAGCGCGTAGCAGAATTAGCGCTAGCTGAGACTCAATCGGCGACCATGATATCTTCA
ACGATGAATGTGCTGTTACGAGTGGCCTCTGCACGCATGAATACGTACAAATTTTCATCGTATACTCAGACGGGGCCTCGTAACGGGGACACTAACGAGA
GAAACTTTGAGCGCatcgagctgaagctgccggaTCTGTCTACATTGGCTCAGCGCTGCATCACGCGTACTCTGCACCAGA