Description :
From Genome Similarity Track
Location :
Scaffold_183:7134- 8668
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_183-abinit-gene-0.23Calmodulin-binding WW domain protein

Sequence
1534 bases(100 bases per row)
ACGTGGTGCTTGGCACCACTTCCTCAGCAGCCCCATATCTCCCGGCAATGGTCGTGCAAACGATCCGCGATGCGCAGCGCTGTCGCCAGCCCAGCGAACG
CGCCGTTCTGTGGACGCAGCGTGCCCACGCGATCGCCCACATGGACACCGTGGCCACACGCGTGCAGTGCCAGTGGCGCCGCCGCGGCGCGACCCGCGTG
ATGCAACTGTTGCGGTCCACTCGCCGGAAGCAGCAACTGCGTGACGAGTACTTGGAAGAAGTGCGAGCCGATTACGTCACGCCAATCTGGCAAGACGAGC
GCGACCAGGAGAAGCGCGAGTACGAGGAGTGGCTGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTAGAGAAGAAGCGCTAGAGGC
GACCTTGCGGTTCCCATGGCGAGAGGAATGGGACGACGCCTCGCAGAGTTGGGTTGTGTATCGCGTTCATGCCGGCGGAGCGGAGGCTGGAGAGGACTAT
TATGAATACGCAAGTGATCGGCCTGTGTACTCGGTGGAAGAAGAAGACGCCGTGGTTCTCATGCAGTCAATCGCGCGGCGGTTCCTCGCGCGTGCGCAAC
TCCATGAACGTCGCAGGCAGCAGCGGCGCGCGGAAAACAGAAATCGACTGGAGCGTCAGTGGCTTTCCGAGGCCGCCGAGCGAGCACAGACGCTGACGCT
GAAGCTGCAGGTAGCGATCACTGCTGACGCAAGCGTGTCGCTCTGGCTCAGCCATCGCCAGCGCCAGCAAAAGCAGAAAGAGAAGCTCAAGGATACGACC
AAGATGGGGACATCCACGGCGGCCGGCAGCTCACCATCGAACAAGAGACTCCGCAAAAAGGCCGCGATGAAGGAAGACGAAGAGAAGAGCAGGGTCAAAA
ATGCTGAGACCGTCGCGGCATTTGACGCGCAGCTCACAGGCGCCGCTGTCTTGCAGCCGTGTGAGGTGACATATCACCGCAGCGTACGCAACGAGCACCG
TCGCCATCAATTGTTTCCTGCCACAGCGCGTCCGCCGAATGCCCACGCACAGGCGACGCTGGACTTTCTCCAGGCTACGCAGATGCTCCAGCGGTCGCTT
TCACTCACGGCCCACACGAAAATCTCGCTGTCGTTTACGCGGGCCGCCCTGCCTTTCGGCTGGCAAGAAATCCCCTCAGGCGATACGCGTTCGTACTACT
ACCACACGGCCACGCACGCGACGTCATGGGAGCGACCGCAGTACGACTTTGACGCCGAATTTGCCGCCATCAAGATGCAGAGCCTCGCGCGCGTCGCCCT
CGCGTACGCCGCCCGAGAACGGGAGCTGGATGCGATCTCGTTTGTGGCGACGATCCAGATGACGCTCCAGCGCGCTGCCCGCATCGGCTGGATCGGCTTT
GGTCTCGAAGGCATGAGTGCGCGTGTTCTGCTCAGTCGACTGGGCCTCGCAAAGCTCGCCGCCGTCAAACATGCAACGCTGGCGTCGCTGTCGGCGGACG
AGCTGCTACGGATACCGGCGTCCACGATGCAAAA