Description :
From Genome Similarity Track
Location :
scaffold_379:7134- 8647
Transcript NameFunction/comments
Pl_105439conserved hypothetical protein

Sequence
1513 bases(100 bases per row)
TTAACTTACATTGAGCCGCACATTCAACTCTAAGTGTCCTTTACTCACCGTTGTTCGAGGGACCCATAGTGACGCTGAACCGCCTCCTGTACCTGGTAGA
CCGAGAAATCCCGGTCTCCAACGGTCAAGATAAAGCGTCTTGCCGCCTAGAAGTGTCATATTGGAGCTCCATGTTGCTGTGCTACCTGCTGCTACATCGA
TTTCGTCGATTTTATCACCAGCGGAAAGGATGTTGACAGTCACGTCCTCTGTGTCAAAGCTTCGGAATTTGATCGAGACGATTCCGTCACCTTCTTTCGT
CCAAGTACCGGTAGTGCCGTTAAATGCATCGCTCTTTACTGACAAGCCCAAAGCTTTATCGGCAGGGCCATCGTCGATCTCACCGATAAATTTTGTTGGA
CCACAGATTGTCTGGACGTATTCACCGATGACACCCGTGATGCCCTTGATGTCCCAAATGCCGTAAAAGGAGAAGGCCTTGTCCGCAATTTTATACGCGT
ACTCTTCAGCAGTAAGATAAGTGCCATTGTCGCTGGTCCCCGATTTGATGAGGTCCTCCACGATGACTCCAAAGGTTTTGCGCAGAGTTGTTCGAGTGGC
GTAAGCTGTTTTTTCGTCCGATTCATTTATTAGCTCTTCCATGCAATTGTTTGTCGCGATCGGAATATCACTCAACACAAGGTTTGACTTGCTCATGACT
ACGCGAAGTTCATTTTCGGACATCTTTGGATTCTGCTTTCGTAGGGCTAAAATTGTCATCCACGTACGATCGGCGAGACGCTTCATTTCATATCCACACG
TTGTATTCGACTTCATCGCAGACTCTAAGGAAGTGACGTCGGTCCCTCGCAGACTTAAGATGAATTCACCTAATAAGACTCTCTTCATGAATGCTTTGAA
TGAGTCCCAACTCGCAACGATAGAATCGGCGTTAGTCATAACTTCCCTCAACACGAGCTCAGCCGTATTGGTGATCTTATCAGCGAATCTAATGTTTGGT
TTGACAATGATTCCCATGCAAGTGGCAATCGCAACAGGGGTGTCAAAAACAAAATTATCCGAGTGATATAAGATCGCCAGTAACTGAGCTTGTGAAGTCT
GAGGATCTGTCACCTTGATAGTGCGGGCATACCTTGTCAATTGTTTCACCAAAATTGCCATATCTTTCGCACATCGAAAAGAAGTTTGAACTGCTTTTGC
CATCAACTTGAACTCTCCGTACATATTGAAGATTGCAAGCGCCATCACCGATTGAAACACGACCACAACCTTGGAGAACACCTCCAGTTTGCAATCATCG
TTCTGACGAATGCATTCCATTCCACACTTGACCGGGAATGAGATCGGGCATTGTGCCCAGCACGTATTCAACTTAATATTGAACTCAAGTGGACAAGTCT
TGCCGATGTGAGCTTCGCGATAGCACGCCGTGTCAGTGGGTCTAGATACTGAACCAACCCAGTTAGTGTACGTGGACTGGATCGTACTGGTGACCGTCGT
TAGTGAGTTGACC