Description :
From Genome Similarity Track
Location :
Scaffold_170:71316- 78759
Sequence
7443 bases(100 bases per row)
GTGAATATAACACACCACTGTCATTTCGATCCCGGCTCCTCGGATTACAAACAACTTAGGGGTATCGTCACTCCAGGTGGCCTGTTGGTCCAGTCAGCTT
TTGCTTAGCCCCCCCCCCTGGCCGACGTGCTACAGCCCTCAGCTCACGTTCCGCGGGTCCAAATCACCTTGCACCGCTGTGGACCAAGCAGCTGTACATG
GTAATTCAGACGCCGCATCGCGCTGTTGCCTCATCCCTGTTGAGTGGTTGCCCAGGTCTGTTCGATACCGTCCAGCCCTTCAGGTCATGGTAGTATCATG
CGCAGGGTGTCCGAGAACGACCCAGCCCCTCACGGGGCTCACACAGTTCCGAAAATGCTCTAAAACTGTCTATTCTGATGCTATGCTTTTTAATTGTACA
GGCGCGGGCTCACTCATGCTCTTAAAGTGTTTTTTGTCTCGATCTCTTGTTCTTGAGCTGTCCTTGTACTTGGTCTTGGGCTCCTTGCTCTTGTGAGACC
GACTGCTGCATTCCTTTCCGTCCCGCCAGAAGTGCTCTCGCAAAGTGTGTTTTGATGTGGGAGCTCACACTTTAAGAGCACCTCTGTATTGCGGGACCGT
AACGACTCTTCTACATGTGGCTGCAACTTCGGTTTGGCCAATTCGCAGCACGCGCCACTCGCTTTTGGAGCGTGGACACTCGCGGTGGTTCTAGGCTCCT
CGGCGCGTGCATGGTGGTAGACGCTCCCAGTCACACCCACCCCAACCTGATTGATATCGCTACCAACTGCCATACCACTTTGGAGTCTCGGGGCAAGCCT
CAGACTGTATCCTAAAAAGTATCTCTTGAATACATAGTAGGGCAAGGAGCCCCACGCCCGTACATACATGCCTATACATTTAAAACTACCCTGCTGCTAT
TATACAGCCAGCGCACCTTGTCCTCTTCGCGCCGTCGCCCAAAAATCCAATTTTGTGTTTTGAGTGAAAAGTGGGTCGAAAATATTGCCCAATCAGGGCG
CGAGCTAATTATGGCCGCTGTTTGGTCATAATTGTAGTTTAGGCATAGTTAAGTCGAGTCAGAAAGATAGGCGCGGTCGGTACGATGGGAAGAAACTGTA
TTAGAAAGGCCGAGTGTAGCCATGCGAGAAGGCAGAAAAAAGCAGCAAGAAAGGAAACGGACGGACTTATTGACAGACGGACAGACACGCTACAAGGTTA
GAAGCGGAGAGACTAGCGCTCTGGGCGCCCACTCCGCGGACGCTAGGTCATGGTTGGTTTGTGTAGTGCGAGGCGACCACCTCCGCTGCGCTGCGGTGGA
CTTAAATTTTTTTACTCAAAGCAAAGCTATATAAACTATATGTAAATCGTGTTATACTCATTTTGAATTAAAATACTGTACTCAGGGTGTTTTTGGTATT
CACATGTTCCGTCTCAGTATCCAGAAGTCGCTTACTGTATGACAACATCGCATATAGTTATGTATTGTGACAATTGGTTGTTACAGATAGTGTGGTGTAG
TATAACACACAAATATCGTCAGATGTGGATTCCTTACACAAACCACAACGAATCGCCGAGTTAGGTCGGCGGTTTGTATGACCTGCGCAGAGGGTGGTCT
CCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGCTTCCACCCGGTTCCGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTC
GGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCAGCTCAGCTAGAA
GTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATGCGGGACTTTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATC
TCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATTGACGGCAGGCATAATCCAGCCATTTGCAGGGACTTACCGGAAAAGTGTACAC
GTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTCTGGGAGCCCTTTCGGCTCCCCCTATTTAATCATATGCTTCTCATACAAATATCTAATGAAATG
TAGTCGTTTCGGATCTCTACCGACCCTTCAGCTGAGTTCCGGCGTCCGTTGAGCTCAGCGGCTGTCCGGATAGCATATCCGGACAGATCGCCGAGTACTT
ACCGTGATCCTTGGCTCCTAAGCTCTATGTTATCAGACCGAGCCGATTCTTGACCTAAACTAGGTCGGCGTATGGTCGAATCTGGAAATCTCTACACCAC
AACTGCCCCGGTTATGATACGAGCCGAGCTGGTGAGTGTCTTAATCCTTCATTTTGTTCTGCCACCGTTGGTCCGTACTCGGCTGATGACGTCTCGCGGC
TCCCCACCACCTTCTTTGGTACGTTCGTTGCTTCCGCTGTCACTCACTTGGCAGCTCCTTACTCTTCGCATGTTGTTCCAGCACAACCCGTGGCACCATC
CTTCTTCTCCAACTCCTCGTCGAGGTGAAGGCGTGCCAGCTGAGTCGATTCCTCGACCCGTCGGTACTCGTGGGGTCAGCGACCGGCATGAAGCTGGGCT
GGTTGACCTGACAACTTCCCATGAGTCTGACGCGGAGTCGGCAGAGTCTTCTCGCGTGCGCCTTCCTGGTCCACCGAGCTTGCCGGGCGACACCACTTCG
GGCGCCACCAATCAGCCAAGCTCGGCTGCTCCAGTGAGTCTTGACTCCCTCATGGCCAGCCTTTTCTTTTTCTCTTCTTAACGAGCAAGGGCATGATCGC
CGAGAAGAATTGACCTTCTTGGCGAGGCTCATGGCTTACGGATTTACTCGTTCCGTGGAGCCCTCCGATCCCGTGCAGCGGCGAGCGATTTTGCATGCTG
CTTCCGCGGGGGAACTGTTGATATCTTGAAAGGCAACTACACCGCTCTTGATTATCCAAAGATCATCGGCGATCTCCAAGCTGACAATCAAGCTGTTCAG
GAGGAGAACCGCGCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAATGTCGACTTGTCAACTCAGCTCTCGTCGGCTCAACAGCAAGTGTCTCGAT
TGGAGGCTGCTGCCACGCAATCGGCTAATCTCCTCGCGTCGCTGCGAAAGGCTGTAGCTCTGAGTGAGGCAAAACTTGCTCGGGCCATCGCAGCTGAGCA
GAGCAAGGTTGACGCTGCGTTGGGTCAAGTTCAGCTCCATCATCAGCAAGTCTTGGATCGAGACGCCAAGATCGACGTCCTTCTCCGATCCATTTCCGAG
AGGGATGCGACGTTTGTCACTCTTCAGGGCATTGCTTCCAAGCACTTCGAACAGCTGCAGGAGTCGGCGCGGTTGTACAGTTCCACCGGTACTCAACCCT
TGCGGCACGCTCAGTCGGTGATCGCTGAGCAGCGGGCTGTGATCTTGCGACAGAAGCGGCTCATCCGTCGGAATGGTATTATTCCGATGCACGATCCTCA
CATGGCTGCTGCTGCTGGCGGTGGCTTGCAAGTTCCTGGGCTTGATCCGTCCGACCTTCTCCTCAACGCCCGGCTGTGTCGTGTCTTGGAGTCTCGCTTT
CCTGAGGTTCTCAACATCCCCGCTGGTGAAACTCGGCGGTTGGAGTTGATTGTCCATCCTCGCCGAGATGCTCCAGTGGCGAGTTCCATTATTGGTCCTA
ATGTGGTTCCCTCAGCTAGTCAAGCGTCTTCGGCGACTTCATTGGCAGACTCGGCTGCGGCTCCAGTCAGCTCAGCGGCGGTAATAACCAAGGCTGAGCC
GACTCTTGCTCAGCTTCACCGTACGCCTTTGGCAAACTTGACCTCGACTCAGCGGCTTCGGCGTTATGCCAATCCCAAGTCTCCCACTGCTGCAGGTCCT
CGTCATCGTGCACCGGCGCCGCATCCGCCTCAACCGTACGCTTGTCCACTCCCCGGAGAGGATGGACACGAGGCTATCAGTACCCTTTTGCACTCAAGTT
CACCTCAAGCTACTGTATCCGATGGAGGAAGGCCTCGCTCTGGAAAGTCCCGTCGTCGGACTCGGCGGAAGAAGGTTCGTCACCTTCAGCTGAGCTCTGC
TACTCAGCCCGCTGTCTCGGCTCGCTCTGAAGACGACGATGACGCTTCGAGCGAAGCTGAGTTTGAGTTTGAGTTGCCTGAGCCGCCCGCCGACACCGTT
CCTGCAGTTGCTTCGACGACTTCGGCGGGTTCTTCGTCTTCTGGTCCTCCGGTGACTTCGTCAGTCGCGGCTACTCGCCCACCGCCGATATCTTCATCCG
ATGTCGTGGCTTCACTGCCTGTCCCGGCTACGAGCGTGTGTGCCCCAGGCTCGACTTCGCCCATCTCCGCTGGGTTGCCCTAGTCGAGCGCACCACTCAG
CGTCGTGCTAACGGTGGTTGGACGCTCCCAGTCGCCCTCTCGGGGTCTGAGCGTATCCACCACGCCGACTGACTTAGTGACTCCGGCCGTGAGTGTCCTC
AGACCGTCTCTCCCTGTGACCACGGCCGTGTTGACGTCCCCATCTGGGCGCCCTATCCGGAGATCTGCTGCGACCGCCCGCACTGTAACTGCTCAGCTGC
TTGAGGATCTCGACGCGTCTGACGACGAGGTGTTAGGGCCTGGTGATGGTTCTGTACCGTCCACCGGCTCGACGAATCCTGCCGCTGGGTCGCTCTTGGA
TCCCATTTCCTTATCAGAGAACTCGGCTGGCAGTCCTTCAGGTTCCGACTCAGCGACCGCATATGCTCGTTGTTCTGTCCAAGCGAGAAATCTTCATGCG
GCGATCTTCGGTTCTGACGACGAGATGAACGATGAGTCCTTGCCGCCGAGTGATCGCCACTCCTCGCGGCCTTCATCGAAGGATTCTGGCGACGGGACAA
GTTCTGCCTCTGCGCCGGCTTCGGGGAAGCAGCAGCATCGCAAACGTCGTGCCTCGTCGAGTCCTACCGGTCATCGGTCGAAGCGATCCAAGAAGCACAA
GAAGCATCACAAGACGCACCGACACCACAAGCATCGGCAGCTTCCGTCGACTCCTGATCCAGCTCCGGCTCAGTCCATTCCGGCTGCTCCTTCGCCGAGT
AGGCTCCCGGTTGTATCGATTCTCTCTCAGCCGAGTTCGACTGCTTCACGTCCGGCTGTGGTCGCACTTCCCAGCGCTCTTACACTCCCGCTGGCGACGT
TACGGACTCGGGCCTCGCAAGCGGTGGCCAAGGATTGTCGCCTGACTCTTCACATGGCTCAACTCCGCGAGGTATTATTCATGCATTTCGGCTCAACTCG
TTGTTGGAATGCATTATTGGATACAATGAGCGGAGGGTGCAGATGGAGCTCGTAGGGGGCAAGAGTCGTGTTCCACCTACGCCGTGTTCTCTTGACGGCA
TTCGAGCTTTCATGGCTGTTTTCGACCCGAGCCATCCTTGTCAGCGTCTTCGGCGGATGCTCCCTGAGCTTCCTTTCTTCTTTTCTCCGTCGATACTGGA
GGAAGCTCGGCGGTGTTTGGCTTCTCAGACCCGACCTCGAACTTTGATGCAAGTTCTTGGCGATGTGTGGGTGAAGCTTCGTGGCGACAGTCCCTTGGAC
TCGGCGGGGAGTCCCATCCAGACAGATGGCCAAATCACCCGCTACTTCGTAGCTCTCTATGAGCGTCGTCATTGGATCGTCGAGTCGAGTGTGTTGATGG
GTCTCCATCCTGACGTCAACCCGGCTGCCACGCCCGCTCAGCTTGCTGAGGTATACGAACTGTGGCTGGTGTACAAGCGTGAACGCAAGCGTCGTAGTGA
CACCTTGCGATCTTTGGTTGTCGCTGTCTACGATCAGCTTTACTCGGCGGTCACTCAGAAACTCGGCGATGAACCTGCTCCTCTGGTGGACGCAGAGGTT
TATTTCGACCCGTCCGTCCCCCATTATTCTCCTGTTAACCTTTTCGTGGGTTCCTTCCGGGAGAGACTGGGTCCCAATGTGCTCATGATGTGGATCTAGC
CGAGCCCTGGCGGGGCTTTGGTGGCTAACTGACCCGGCGGTCCACCCGTATAACACCTGTTTCCGCGCTCGAAACGTGGACTTCTTGGTTTTCGCTCCGC
GCGGTATGGATCCTCAGGTTGTTGACGACGCGATTGAAGAAGACTTTGATCTTGCCGAACAAGCGCCTCCTGCCTATGCCCCGGGTGCTCCAACTCGACT
GAATCGTCAAGGCATTCATATCTCCACTGGGTCTTCAATCGGTGAGCTCGGCTCAGATGACGAGAGTGCGTCTGATGACGACTCGGCGGACGATGGGTTG
GGTTCTCCCAATCTCCGAGGCGCGTCTCCGAGTATGTCTCTGTTCGGCACCCCACTCCCCAGTGGAACGGATCCGCCTCAACCCACTTCAGCCGAGTCGG
GTCCTGAGGCATCTGGTTCGGCTTCAGCTCCGTTGGCTAGCTCGGCGATGATACTTCTTGCCACGGCTGCGGATGTTGCATCTCCTTCCGCAGCTTCCCA
AGGGATGACGTCTGCTACGACGCCACGCCTCCAAACGTCGAGTCCGCTGAGCTCTTCCCAGCTGTCTCCGTCGGGTTCAACTCACTTGGAGTCCGGATCG
CCAACTTTTTAGTTTTCTTCTTTTGACTGGGCGTCCCGTAGGTATCGTTCAGGACTTCATTTCGTAATTATTCAGTATATGTAGTTTCGACACAGTAGCA
TTCCATCTCAACTCGGCCTGTGTCGTCCGCTGAGTTGGGGTAGCTTTTGGTGCAATAGCTGTTAATCCTCATCTGCAACTTGCACCATTTGCAGACGGTT
TTCACGCTTCTTCTGTCGTAGATAGTCAAACAGGAGACCTCCACATGACAAATTCGACAGTGGTTCCCAAGTAGGCTCATCGTAGCCGACCCACTTAACT
TTAAACTTCCGTTGTGATCGTGACGTACTCGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTCGACTTCATACTGGTTCGTACTTGTGTCTGGCTCCC
AGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATTAGTCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGAC
TGCCTTCAGACGTGATACACGGACCACTGGGTAGAACCTATATCCGCTCTTGTCGGGCAATTCCAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACC
CTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAAACAACCAGACTTGATCTCCTTCTTTGAACAAGGATT
TGGTGGATTCATCGCCTGGTTCTGCAACTCCATCTTCGTCATCTGCTGTGCTGGGAATGGATCTTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCATTCG
AGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAAT