Description :
From Genome Similarity Track
Location :
Scaffold_83:71309- 76578
Transcript NameFunction/comments
Hyaar_Emoy2808567hypothetical protein

Sequence
5269 bases(100 bases per row)
AGGAGCTGTGTAGCTCCGCTACACTTGGTAGCGCTCGTAGTCAATCTACTCCTGAGTCTTTAGATACTGATCCTCTATGAGGATGTAAAACCCCACCCCC
CTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCAAGGCCCGGAGGTGCTGACTG
CACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGCCTACACGCTATGTGTCTGTACCAGA
CGAAGAGGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAATAACTACTCAGGAAAGGAGGGTGAAAATCTCATCCTCTGGATCCGTGAGATTGAGATGGCC
ATGGGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATCTCAAAGCTCGATGGAAGAGCTAGAGAATGGGCCTTGACGTGTAGCACGT
CGGTTGACTTAGCGTTTCCCACATGGGAGTCGCTTGAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGATTACCGCGTGCGTTCACGCTTTTT
ATCAACCCGTCAGGGTAAGAATGAGTAAACGGACTATGTCCAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTGCCTGAATCAGTCCAT
GTGACTATATTCATGGAGGGTCTCCGTACTGGCATTGCCAGAACCGAAATCTTTCGGGTTCACCTCTCTACAATCGAAGAGGCTGTGAGAATTGCTCCTG
ATGCTGAGCATAACTTCAAGTCGGACAGACTTGGCTGGAATGGGTACAACCCTAGCTCTTCGAGGGCAAACTCCACGAGTACTCCGGCCGTTAATAGGCC
GGAACTGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGCTTAGCAGCAACGTGTTGTACGACGGCGTTATACGTGCGGAAGC
ACTAAACACTTGCGGCCTGGTTGCCCTTTGCGTATACAGCACCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTCTGGCATGGCACGAGGAAATG
CCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTTAGGAGGTAAAGTTGAACAGGGCTTAGCCCCAAAATGTTC
CATATCCACTGTTATGGAGCGTGGATACAAGTCTGGCTTGTTGGTCACTGAGGCGAAAGTTAAAGGCTTCGAAAAGCCTTGGTCGATTTTAATCGATTCT
GGGGCATCTTACAATTATGATCGACGTCGTTCCCTTGAGGGAAGTCAGCGTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTCAATCACGGTTCGTT
TAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTGTTTTTCCGTTGAACTTAGGTGTAAAGTTTTTGGACTTTAACAGCACTAAACGCTGTCTTGTCCTT
GATTTGGACTCGAGATACGATCTCATCCTAGATATGGCTTGGCTTGAACGCCATGAGCCATGAATTGATTCGAGGTCTAAGACCTTAGGCGCTACGCGCA
ATGTTCCTAGCGAAGTTTTGGAGAGTCATGAACCCACCTTTGCTAGGCGACAAAATTAATATTGGCGCGAGCCTTTGACAGAAGATGTCAATTTGCTGGA
CATCGGAATGTCTGAGTAAACTAACTCCAATGTTGAAAACACAGATTCCGAGCATAGCTTGTTGAGTATCAGGGATACGGCACGTACTCCGTTGAGTGTT
ACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCATGGTTGTCCTAGGGCCGAGTTATCAAGGATGTGATTTCTTTGATGTGTGTGTGGTGACACGTG
AAAATTTACCGAGTGCGGTCGGCCGTGAAGGCACCACACTTAGTGTCGGTAATGACATTGTTGGAGAAACGCCATTAAGTTCAGGGCTAGGCCCGTATAA
TGTAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTCACCGGATGTCGATCAAGACATCAGATCTCGTATAGAGCGC
ACTACTACTAGTAGTAACCACGGGGACACTATTGTCCCTACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGACGCCAGGTGACAACTATTA
AGCGCCAGGCGTCCGAGCAGTCACATAGCGACAATCGTGATACACTATACACACTTGTCAACGGAGTGACTGGACAGGTTGAGGGCAATGTTAGTCCGGA
AACCCTTCCATCTTTGGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGTCCTTGAAGGCAGGATATTTATCCGAATTAGTGGTC
ATTATCCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATTAGTCGGTCGTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCT
TAAAGATCCTTTGGATCCCTTCTATCTTTTGGTTAAGGAATTTCAAGATGTGCTGTGTCACAACCCACCATCTGTCTTACCTCCAGATAGAGGTGTACGT
CATGAAACTGACTTGGTTCCTGGAACCAAGTACTGTGTTACAAGGCAGTGGCCTTTACCTTAGGAACAGTGTGACATCATTGACGATTTCTTTCGTGCTA
AGCACGCGGCAGTAATGGTGCGGGAGAGTAAGTCTCTCCATTCCACACCGACATTTGTGTCAAAAAACCTAATGACAAGTGGCGTATTGTGCACGCTTAT
TATAAGCTTAATGCGGCCACTATATCGGCACAAACATCCATTCCTAAAAAGGACGTTTTTCAGAACAACATGGCAGGATGTACAATGTACAGTGCACTCG
ACCTGGTCGATGGCTAACATCAACTGCTCATGCGAGCAAGTGATATCCCGCTTACAGCGGTTAGTACTCCAAGCGGTATGCTTTGGAGGTGGCCAATTTT
CCCCCAGGGACTTTCCAGTGCCCCGGCTACGTTTAATCGCCTGGTGACGCAACTTTTCCACCCACATCGGGATTACGCACAGACGTACTTTGATAGCATT
TTTGTCCATAGTCGTACCAAAGAAGGTCGGTCAGATGTTGAAAATCACATCGGTCATTTGCGAGCCGTGCTCGAGTGCATGCGCACGAATAAATTGTATG
CAGATGCATTTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTATGGGTTGTTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGC
CATAGTCGATTCACCGGTTCCAAAGAATCAAAACGATCTACGTAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTATAGTGCGAATTACGTAGATATGG
CTCGGCCATTATCCAATCTCCTTAAGAAGGATGCGGATTGGCGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCTTTCATGC
GCCAATACTGGCTTTGCCCGATTCTGATAGGCCTTTCAGTGTCGTCTGCGACGCATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGAT
GGACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGACAAAGATCTACTTGCTACGAAGTATGCGC
TCGTCAAATTTAGAGTCCATCTGCTTGGCTCAAAGCCATTCGTCGTCTATACCGATCATGCGTCTTTACGCACGGCGACCCAATCGCCTCACCTATCGCA
GAGAATGGCTCGTTGGCTTTCATTCTTTACCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGATGCGCTATCGCGCCAA
CCTGACTATGAGCTTGATCACGTCACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCGGATTATGCCAAGGATAAACAATATGTAGCTTTGCTAC
GTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATTACCTTGTCGGTACGTTCGCGTGCAAGGATACATCGATTTTCTATCGATAACGGCTTGTTGTG
CTATCGCACGGACGCCGCGGATACCCCGCGTATCATTGGTTCTCATGATGAGAAGTTGAAATATCGAATCCTCTATGAGGCACATGATACAGCTTTAAGT
GTTCATCTCGGTCGTGAGAATACCTATAGCTCAGTGAGCTAGAGTTATTGGTGGCCTAAATTCTATAAATGGGTTAGCAATTATGTGCACACATGTGAGA
CGTGCCAACGGGTCAAACCCTCGGCACATGGGACTGCGCCTCTGGATAGTTTGTCTGTACCCACTGAGTGTTGGGGTCCATCAGCATGGACTTCTTGTTT
GGCCTACCGAAGGATTCGGATGGTAACACAGGCATTGTGGTCTTTGTCGACCGTTTGAGCAAAATGGCTCACTTAGCGGCTGTGCCGGACTCTATTGATG
CCGAAGGTACAGCGAAGCTTTCTATGGACCGTGTGTTTCGACAACATGGTTTGCCAGTGGCAATTGACTCTGATAGAGATCCCCGCTTCACTAAGAAGTT
TTGGAAGTCCATCTTCAAGGTGCTCGGCACCATATTAGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCAAACTGAGCGTGTTAATCGCGTCATT
AATGACATAATGCGCAGTGTTTGCGCTGGTACGCCTAAGCGTTGGAGATCCATGCTCTCTGTTGTTGAGTTTGCGTTGATCAACGCTGTTCATGCCTCTA
CAGGCTATACTCCATTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGATTGGTGGGGGAGAGGTTGCCGA
TCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTCTTAATACATGTGCGTGACGCAATGGCT
GAAATCCAAGACCAACAAAAACAACAAGCAGATGCTAAAAACAGAGTTTGTATTGAATGTTATAAGGCCGGAGACCAAGTATTACTCAAGGCTAAAAACT
TACCTACAAATGTATTGTCCGCTGTGTTTAAGACAAAGGTGCGTCCACGCTGCATTGGACCATTTACGGTCACTGCCAAGAACGGACTTGCGCATACGCT
AAACCTTCCGCGCAAATTGCGCACACACCCAGTGTTAAACGAAGGCTTACTTAAGCCGTATCGGAATCC