Description :
From Genome Similarity Track
Location :
Scaffold_19:71300- 74369
Transcript NameFunction/comments
Physo_132056reverse transcriptase

Sequence
3069 bases(100 bases per row)
GCTTCAGCTTGTTGCTCTCGACCGTGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGATAACTAAATCCCCAACCTTAAACACGTTCATGTTTCC
GCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCGCCATGGTGTTTCGCACCCTGCTGATTATGTTCAGTCTGTCTTCGGCAAACGAG
GACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGCTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGC
CTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGATAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACC
ATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCT
GCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAAT
GGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGCAAAGTGGACCATC
TTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCG
CTGGGACCGGCAGGCTCTGCAATGGTGCCAAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTA
TACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGCAGCGTCGTGCGCCTCCATCAGGATGT
CGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGACACTATAGTGGAGCAAACCATCAGCCCACTCATAGCGGTGCAG
CCTTGCATGTTGTCGGGGCGTTAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGCGACTGGCATCGTCTCGGTACCCC
AGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTAGGGTCGGCGCGACAGCGCGTCGGCAAGCACGTTCAACTTGC
TCGGCTTGTACCCGACACAGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCGCTGTGAGAGATGCGGCGTGTTGACGGCAGTCCACAAGGA
CGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGGTGCACTCGGAACTTGACAAGAGCGTACTTCATGGCAAGTAGCTCCTTGTCGTGGACT
GGATAGTTCCGTTCGGATGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCATCGTCGGCCTGCATAGCGCACAGCCAATTGCGTA
GTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAAGCATCT
TGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAAGCCGGTGCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGT
TGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGATGGTTTTCACCTTCTCCGGGTCCGCCCAGACCCCGACGCT
GCTGACGAAGCAGCCCAGGATCTTGATCTCCTCAGCTGCGAACACACACTTGTCGATGTTGGCGTACAGCTTGTTCGCCCGCATGAACGAACACACGTCG
AAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGGCGAAGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGT
CGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCA
CAGCCGTGAGTGGGACGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAGGTCCAGCGCGCTATACAGCGTGCAGCCGACCCTGTTGCTGAG
CAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGCCCAGCTTGTTATAAGCATGAACCAGACGCCACTTTCAATTCGGTTTGCGA
ACACAGAAGGTAGGCGTCGAGTGCGGGGGCTTCGACTCCCGCACCATGCCTGCCTTCGCCTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGCTCCC
GGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATC
CTTGGACACCACGTCCTCAAACTCCTTCACCAAGGGGTACACCGGGTCCCGGGGGTTCTTAAGAATCTCAGAGCCCATGCGCGACGCGCGCTGTCTCTGG
AACTCCTCCAGGACTGCCTGGTCCATGACCGAGGACGAGTTCAACTCGGCCGACGTGGACTGCGGTCGGAGGAGAACCAACTGTGCGATCTCCCCGGCCT
TTAGCTCGGCCAAGAAGTCCTCCATGGCGAGCTCCTCAAGGTTCAGTAACTCTGAAACCTCGGGCAGAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCG
ACGACCGGTCACGCCGTCGAAGATGGGATAACACTCTTCGGCGGCTGGAGCCTTGGCTGGAGGCTCGGAGTCGCTGGCGACTGGCGTCGTCGGCCACACG
ACTAGGCCCGGCTTACGACGTGACCCTCGGGTGTCTTCGTCTCGTGGCGCCGCCTTGACGGCACCACCG