Description :
From Genome Similarity Track
Location :
contig_118:71293- 72613
Sequence
1320 bases(100 bases per row)
TCAGGAGTAGCTGAAAACTTGGGAATCCGTGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTAC
ACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCC
GTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATC
GTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCC
GGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTA
TATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCA
TAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTTATACATATGGC
GAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTC
TACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTC
TGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCC
CTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAA
CGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGG
GGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAA
ACTACCATCGTCAGGAGTAG