Description :
From Genome Similarity Track
Location :
Scaffold_1:712633- 717861
Transcript NameFunction/comments
Physo_127183lactamase, beta 2
Physo_127184hypothetical protein

Sequence
5228 bases(100 bases per row)
ACCGCCGTGAAGACGCAAACATCAAGAAATGGTTTTTGTGGTGATATTGGGCTTATAGTGATGGCAGCTCTGGCGAGCGAAATAAATGACGCATGGAACC
TGGTTTGCTTAGCGCATATGTACAACCGCGGGACGTGCTCGTTCCGATCCAGCTTCCACGCAAGCAGGATCTGGCGCAGCTTATGAGCGGGTGCTGCTGA
GTTGACGTGCCAGCTTGAGGTTGTCCTGGATCTGCTGTCGGGACTGCTCGGCGATGAGGTTCATTTTGATGATTTGCGTCATGAGCGAGTCCGTGGAGGT
GTCTCCGCTGTTGCGCTCATAAGACAAGGGGCTGCTCAGGTTCCCGCCGTAAGGTCCCGCACTCGGAATCGAACGGGCCCGGATCAACGCCGTCTCCGAG
TCGCGCCCCCTATAATAGTTGTCTTCTGGACTGGGCGGCGGTGAGCGGCTGTAGCGGCGTTGAGTGTAGGCATCCATGCTGCGACTGCTCTTCACAGGAC
CATCGTAGATAGTCACGGCAGGCATCGACGACGAATGCGTTGGCCGCCCGGGGTGCTTTGGCAGAGGAGCAGCGGCTCCTCCGGACTGCGTATAATAGTG
GGTCTCCTCGTCCTGGTCGTGGCGATTCACGCCAATTCGAGGCTGCGGGAGCGCGCGGAACGAGCCGCTACTGCTGCTGTGGCTGCTCGTCACGGACGTT
GCCTTGTGTCGGAATCGGTCTTCGTCCAGACCCTCCCCGCTGTCGTCCGTGAGTCGGCTCGTTGCCCTGCCACGCGAACTCATGAAGCTGTTCTCCGAGC
TCTCGGGCCCGGTCAGCGACGCGGCGGCGTATTCGACAAGGTTTTGCACACTTTCCGGAGCGCGCAGATCCACCTGGTGAATCAACCGGATACACTTCTT
GCAGAACAGCTCGTGGTGCGGCACGCGAAAGTCGTGGAAGCTGAGCACGCGTACTTTCGCGACGCAGCTGGAACACGTGAGACGGTGGCACACGGCGCAC
TGTTTGGACGAGCTGAGGAACCCGGACGCCTTGGCGTGGCACACCTCGCACTTCTTGTGCGTGATGAACGGCCGCACCGTGTACTTGCCGGCCTCCACGA
GCGCGGTGGCAATGACCGCGTGGGCCACGGGCATGGCCTGCTCGATGCGCAGCCATAGCTCGGCCGACTTGATGTCCGCCACCCAGTCCACGACCTTCCC
GCCAGCGTCGTTCTTGCCACGCATGTAGACTTTCACTCCGCCGCTCTTGTTGCGCTTATACAGGTAGCAGATGGAGAACTTGGCGCGCACGCACTCGTTG
AAGGTGGGGCACGTGGGCAGCTCCACGGACTCGGTGAGCGTGTAGCCGATCTCCTTGCCGTTGCGGTCGCGCGTCATGCCGACCTGCTCGTACCAGCACA
CGTCGCGGTTCTTGACGAGGCCCTTGCCGGGGGACTCGACCGTCATCCACTTGAAGCAGGAGAGGAAGAAGGGGTCCTCGGGGCTGCGCTTCTTGATGAC
GCCCAGCACGGCGCAGTCGACGATGTCGTCGCGGTAGACGCCCGAGATGCGGCGGAAGTCGGGCGTGTTGTCGGCGTAGCGGCCCATGACAACCTCGTCC
AGCGTGCCGTCGATGCGCCCCGTGCAGAGGAACTTGTAGTCGCCGTCGTCCTTGATCTTGCGCCGGCGGTAGACCGTCAGGTCGCGCCGCTGCTTGATGG
GCTTCCACTTGCGCTCGCGCATCTCCTGCGTGTCGAACTGCTCGCGGTGGTACGCGTCGATGGTCTGCTGCAGCAGCGAGTCGCCCCACTGGAGGAAGGA
CTGCGCCTCCTGCTTGCTCAGGCGCAGCGGGGGGAAGAAGTCCAGCGGCAGCGGGAACATCATTCTGTCGTCTGCGGCCTCGGCCCTAGCGGAGCTGCTG
GGAACTGACCCACGGGCGCATCAAAGCCTTCGAGCGCAGGTTTCGAGCGGACGATTGCGGGGACGGATATAAGAGCAGGTTGGGTTGGACAGCGCAGCAT
ACGGGAAAGTAGTGAGAGAGATAAAAAGTTACACATGGACAGCACTTGAACGTAGTGGTTGTGACTCACAACTTGTGAGTTGCCAAGTGCACTGGAAGTT
GTAAGCCGGGATAGTAGACTTGCAGCTGGGCAGGGTTGGTAATGCCGAACTACGGACTCGCTCCATGCAGCGCCGGACGCGGGCATTGAGCTGAGCTGTG
CGCGCCGTAAGTGGACGCGGTGAATTGCTGCGCCCGGTGTTACCAAGGTGGAGCGAATCCAGGTGGAGGTTGCCTGTTAAACGGACAGCAAAGAGCAGCG
CGCTCGCTCGCTGCTTGGCGCTTACGCGTGGCCACCTGGTGCGCATCCCGGAGGAGCTGCTCACGGAGGCATCCGCGCGTCGTCGAGCTTTCGACGTGTT
GGTTTGGCGGTAAACAAAGCCTGCATGCTTCAACACCAGCAACCAAGATGCCATTTCGCTCCCTTCTTTCGACTTCAAGACTTTCATTCGAGGGACTTGG
CAGGATATGCACGGCAACACAGAAACCAGAAGTTGCAAGGGACGTTGCACAGAGCGCGCGTGCGTGTTACGTGCCGAAAAATTCGTCACCTGCGAGCAGC
TTGGTGTCGACAAGATCCCTCCCTGCCGGCTGGGGCATGGAGCGCGGAACTCTTGGGGCGCTTTGTTTTCAATGCGCGCTTGCCCTAGAAACGAGCGCAT
GGGGCACACGATGTGAAGACCAACAAGTACGTCGCTGTCTTCGTAGCATTACGGCAGCACGAATGGTTGGCCACAAGCGAGCTATGATCTTATCGTACAT
TCAGCTACCGTACCTGAGTCAGCCCAATACATGTAGCTGTTTGCGCTTGTTGCTCAGCAAGCGGATGCCAGTAAGCATCTTGCGCTTGTTGCTCAGCAAG
CGGATGCCAGTAAGCATCGCACCTTGCCTGTCTGATGAATGCGAGGATACATTGTGCGAAAGCAAACTAAATCTTGTAGAGGCACTTCGAGTTGCAAATC
CTTGCTCATTGCAGACATGGCGTCATGGTCCCTATAATGCATGAGCACCACTGCACTCCATCGCTGCATATGTGGCTTCGCCTCTTGACTTTCCGTCCGA
TGGGGCTATTCTAGCACCGGAACGCGAATTTAATAGGATGTCAAACACCGGGAAACTTCGTGCTCAATGTTACATACCCATATTCCATCGGCTGCCGAGC
GTGTGCGGCTGCGCAGCTTTGTAAGAGCGTGTTCGCTACGCAGCTGGAGATGGATATCTGCAGGGAGTTGGTGCATCTCCATCTGCTTGTTCGCTACAAC
AGAGCGCATCTAGGTAAAATTAGCCAATCACAGTGCAACTGCAACGACTCGCTCTCCTTCTCCTTACTTTGCTGTTTCTTCGTCGGGACCGGACTCGTGG
CAAGACCAAGCTGCCGATGACGCTCCGAGAGCTGCGCCTCCGTTTCCGTCAGCCAGTGGCGACCACCACACCAGGATAGCCATGACGCGCAGCGAAACCT
GACTCGATCGCATCCCAGTCCTCTCTCCTCCGTGGAAACGAAATGACAGCCGCCGCCATTGCTCATAAGACGCGCACCACCTCGGTCGTAATCTCCATTA
CGTAGCTCCGTGACATACCCAATGCACCACCGACCTCTCGGTACCCACCAGTTGAGCCTAAAAAGTAAAGCGCGGCTGCAACTTTCTTCTCAAAGGTATG
CTGCCGTACTTTGGCAGCAGCATACAGAACACCTTGATCTCGTAGTAAACCAGCAATCCGTTGGAAAGTCGGCTTGGTACAGCGAAGATTGTCTTCAAAC
CAACTTGCATACGCGGCTGACTGTAGCATGGGCTCAAAGTGCAGTGAGGTCACGGTACGAATCTGTTCCTTAGGGCCTCGTGGCGCATCGTCGGATTCTC
AACCAGTGCAGCTTCCTCTTCGTCCATTGTCTGTGCGGCTGAACTGCCTCAATCTCCAGTTACTTTCTCCTTCTCCAGCTCTGGGAGCTGGAGAAGGAGA
CGGGGTAATTCTCCAGTTGTCACGTTGTGAACTAAACTATTTTGACCAATCAAAAGACAAGAAATACGAGAGGCCATCTCCATCTCCAGCTACCTGGCGA
ACACGCTCTAAGCATCATCGGAAGCTGCTACGTGTACCGTACGCGCAACGGTGTGAGGAGGGAGGGGTGCTTGATTTCTGCCTGGTCGCATCACCATGAC
GCAGGAAGCCCAGGAAGAGACATGCACGCAGACGCATTACACTATCGGCTGGAGTACAGATTTCGCCCACACTTCTGACACCGTGATTAACTACACCGAC
CACAGTATTTAGGTGTTAGTACTGTAAAACCTGTGATTGTGCCCCCTCCCTTCAATAGTACCCCACCCCCCGAAGTCGTTAAAGCAACGGCAGGACTAGC
GACTCAGGACTAGCAACTTCAGCAACGTCAGGATATCATAGGGTTAGGGGATGGATATTTCTGCAATTTTAATTTATCGAATAGTTATTGTGAGAACCGG
CTAAAACGCATATCTGTAGCAACCCCTTATTAGACCTCAACCACTTAACTAATCAGAGTACAAATCAGGGCTGAAATCGATCGTGATCTAGATGCATCGC
TTGCCTGCGCGATTGCCTAGGCATTCTGATGAAGCACGGCTATATCAACGTGGCTTCCATAAAACGATCGCCTAATCTGCACTAGAGTTGGTCAAATCTT
TATCCAGTTATTACCAGTTACCGTTATTACCTTCGTACTTACCATTTTTTAACGTTAATAACTTTTATGTATAGTTGGTGTGGCAGAAATATTCGATCTG
CTAACGGTAATACCTCATGTGCATAGTTGGTGTGACAGAAATATTCGGTCAACGCGTTTCGTGAAGTTGTCAACGTACGTGGAGGTCTACCGACATGAAT
CTGCGTATGCTCCACGTGGCAGGCAGCTCGCGCACGGGGCCTATTCTCGTCGCTGCATTCGCAAACTTGCTCCTGTAGAGCCTGCAAGCTCCATGGACCA
AAACGGCCACCGCAACGAGGACCGGGCTAGCAGTGAAGGGTCTGGCCTTGGTCGCCCTTCAGTTGGCGTGTGGACCGAGTACATTGTGGTTGTGCCACGT
TGGGCCAACCCGAAGAAGCAGCACACCGACGTGACGTGCAGGCACTGCTCCAAGCTCATCAAGAATGCCCAGCCCAAGAAAAACCTCCGCACACATTCGC
AGCTGTCCCTGCGCCCCAGCGGACGTCC