Description :
From Genome Similarity Track
Location :
contig_50:71206- 72601
Transcript NameFunction/comments
g10359.t1hypothetical protein

Sequence
1395 bases(100 bases per row)
CATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCACGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCG
TGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGA
AACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCGCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACAC
GATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGTGAAATCGGACGCGTCGCACACAACGTGGAATGGGCGATCTTGGTCGACCACCGC
CAAGATCGGCGCCTCAGTCAAACCCGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACA
GCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCTTGTACATTTGAAGGCGTAGGCCA
TTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTC
TTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTTCACATTCGATCTCCCATTCACAGCCCGGC
TGTGAATGAACACGTCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCATCAG
CACCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAAGATCTGATAGAACCCG
TCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCGTTTCGAGGTATCGGCGTCTGCGCCGGTACCGCCGCATCGT
TCAGCTTGTAATAAACATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCC
TGCCTTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGGCACGAGA
TCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGG