Description :
From Genome Similarity Track
Location :
Scaffold_807:712- 2408
Sequence
1696 bases(100 bases per row)
ATCTATTTATTATGAACTGATGGCTGGTCCGGCTTTTTGGTCATCCCGAATCTTCTTTAGGTCCATTGGGTTTGAGAGTACTTCGTCGGTTTGGGTAGTT
CCAGTTTTCCTAGCTCTTGAGCTGAGGTTACTGGTACTCCGTTATGTTCCCGGAGCTTCCTGTGCACCATCTccattgttgtcggctgaAAACTACAGCA
CATCTGAGAACGGTTGAACttggagggggggggggNgggggggggggctgcacgccacgctgctgcgtaATTGGCGTCATCTCCTTGAATTCACCGTTCC
ACTAAGTTGCATCGTGTCGACCTGAGAGCATTGTGTACATCTTGAAGTCCTAGGCGTCCACTATTTGTGGTGTGAAGACTATTGCCGGGTTGAATTTATG
CttcgttggtgctgtgctGACCATACAAACTGCTTCGGAACGTTTTCCAGTTTTTTTAGTGTGGCTATGGGTGGTATGGACTACTTGCCCGTATACAGGA
TTGACGGTGGGGCTACAACATTGAATAGCATAACCCACTGTGCTACCAAGTTAGCTAGTGTTGTGGCTACTCGAAATCGTCATTGCACTTTGTCATGCCC
TATCTCCCagttttcttcttttgcgtATTTATTGCCGATCCAGTAGCCGAGTTGTCGCGTAGTCACTGTTGGTTGGAGCTCTGGAAACCCATCCCATCTT
GCAGGGGTTCCTTTCGTGTTAAGTCCTATCAGAATACTATTTGGGGGCTGCACCCTGAGCCCTGAAAGACCTCCAAAGCTTTTTATAATGTTTTTCACCG
TGTCCAGTTCTTTGACTGAGTTCAGGAAAACTGTACTATCGTCTATGAAAGCTGAAAAGTTATGGCGACGTTCTGCTGAGCATGGAATTGCTATGCCTTG
TAAGTCTGCATTTCTGTTAATCGCTTGCCCCAATGTATCCACTGTCAATATGAATAATAGAGGTGCAAGTGGGTATCCTTATCGAATCCCTGAGTTTATT
TTCCACTCCTTAGATAGTTTTCCATTTTCGAGAACTTTTGCTGTGGTTCCATCATGCATTTGTCGTATAGCATTGATGTATCTTTCCGAGAAGCCATATA
CCTTAAGGGCTTTGAACATAAAGCCCCTATCAATTGTGTCATAGGCTTTCCTCATAGCATCGCTGCACATTCTTCCCATGCTGATTCTGGTATGTTTCCG
TTTGTCCCGAAAAGCGTGCGCAGGATTGTTATTGTTTTACCAATGCTGCGACCTCAAACGAATCCTTGCTGACTAGTGTCAATAAGGCGTGCTAGTAGAG
GGTGAAGCCCTTCAGCTAAAATTCGTCCAAATAATTTGTACGCTCTGTTTAACAACGCAATGGGCCAGTAATCCATGGCGTCCGACGAATCTATCTTTTT
TACGGAGCGGAATCACTGTTGCTTGCCGAACCGAAGCTAGTACTCCTCCTCCGTTGAGTGTTGCGTTGTAAAGCTTTGTTAGGCTCGGTGTTATAAGTTC
TTTAAAGTCCTTGTAGCAATAATAATTCCACCCTGAGGGGCCGCCGGACTTCTGGTGTTTGAGATGCTTTATTACTTGGCTTGTTTCAGATTCACATTTT
GGCTGTATTAATGCTTCAATATCCGTGGCTGTTAGTCGCTGGTTCTCCGGGATCTGGACAAAAATTGGCAAATGCTAAGTTCTCTTGGTCGGCCTG