Description :
From Genome Similarity Track
Location :
Scaffold_4351:712- 2303
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4351-fgenesh-gene-0.0Glutamine cyclotransferase

Sequence
1591 bases(100 bases per row)
TCTCGCCGTGTTCGCCGCGCTCGCGGCGTTCGCCGTCCCGGCCGTTTACTCGTCGCTACTGTCGAATGACTCGCTAGCCGATCGCGAGCAGCTCACCTCC
AACAAGGTCGCAGCTGGACCAGCACGAGCGCATACGACTGCTGGAGGCAAACCGTCCGTCGTCGTGCTGGCCTCGTATCCACACGACACGGAGGCGTTCA
CGCAAGGCCTGCTGGTCGCGCGGCAGGGCAACGACAAGTTCTTCATCGAGTCGACGGGGCTCTACGGCAAGTCGACGCTGCGCAAGGTCGAGATCGCGAC
GGGCAAGGTCGAGACCAAGCACGACTTTGACAGCAAGGTGTTTGGCGAGGGCGTGACGCTCGGGCGCAACGGCGAGCTCGTGATGATCACGTGGCAGGAG
AAGCGCGGCTTCACGTTCTCTCTCTCGCCGGCGCAATCGAGTGGCGGCTCCCAGTTCAAGCTCCAGAGTGAGTTTCCGTATGAGACGTTCACGAGCGAAG
GCTGGGGCATTGACTATGACGGCAAGCACCTCGTGGTCTCGGACGGCTCGGAGAAGATCATGTTTTGGGACCCTGCGACCAAGACGAGCGTGCGGGAGAT
TACCGTCACGTACGAAGGCGACGTGGTCAAGTACGTGAACGAACTCGAGGTCGCAAATGGCTTCATCTACGCCAACGTGTGGTACGAGAAGGTGATTGTC
AAGATCGACCCGGCCGACGGCAAGGTTGTCGCGGTCTTTGACTGCACCAAGATCATGGCGCAGTCCGGCGCGACGCCCGGTGATACGAACGCCGTGCTCA
ATGGCATTGCGTACGACGGCGACGAGGACGTGTTCTACCTCACGGGCAAGCTCTGGGGCCACGTGTTCAAAGTGCGACTGCAAGAGTAGCAGGAGAACGA
TAGGGCTGAATTTCTCGGAATTAAAAACGTTTTTTCTCCTGGTGGCAAGCCCATTGTGCTGTAGGAGGTGGTATAACGCCCAAGAACACCAAGCAGCTCT
GGGCGACCGAGGGTATCGAGGTTGTCGGGCCGTCGGCGGCTTCCATAGCTCGCTCGCCGACAAGGAAAGTACTTCATCAAGAGGGTTAATACGCCTTCCT
TGTGAGTATGCGTCATCTGAATGAGCTCAGTCGTTTGGGCGAGCTTGACGTCTGTCGGGAGACCGAGTTCGTGGATGGCCTTGAGCCCTTCGTCCGGCAT
CGACCTACCTCTCTCTGGGCGGCACGAGGGGCGTGGTCAAGTCCATCGCCAGCTCCTCTAATAACAACTCATTGAGATCATCCCCGGTGATCCACAAGTT
GGTGAAGGTCTGGTACGTAGGCCCAAGCAAACGCCAAGATGAAGGAGGGATGGGTGATTATGTACCATAAGTGGTGTGTTGAGTTCATCAGAAAGCCGAC
GAGGGGAAGAACTTATCACATAACAACGAACTGTTGTGCATGCTCAGCTGTGAAAGAACTCGTCCACTTAATCAATTCGACGCTGTCCGAGCAGCCGTAC
GGCGACACAACAGACGCCGTCCAGCGTTGACAGCACGTGCAGGCCAGCTACGAGCATCTCGGCGAGATCGCCTCCATTCTACAGAGCCTGG