Description :
From Genome Similarity Track
Location :
Scaffold_10:71194- 76221
Transcript NameFunction/comments
Hyaar_Emoy2801907Rab8 family GTPase, putative

Sequence
5027 bases(100 bases per row)
ATGTCTATGTTTGTTGTGTTGACAGATTTGTAGCTGCTGACAATGGCGCGTCATGATACCACTTTTGACATGCAGATCAAGCTGCTAATGATCGGAGATA
GTGGTGCGTGCTGCTTGTGTAGACAGCTACGCAATGCTAGTTCTGGGCGTAGCTCTAGATCAAGTGTGACGTCCAGTACTGACGAAAGTGGTGTGTCTCA
GGTGTGGGCAAAACGTGTTTGCTGCTGCGATACGCGAACGACTCGTTCTCCCCGACCTTTATCACGACAATTGGCATTGACTTCAAGATTAAGAACATTG
AGGTGGACAGTAAGAAAGTCAAGTTGCAGATCTGGGACACTGCTGGCCAGGAGCGCTTTCGCACCATTACGACGTCGTACTTTCGTGGTGCGCAGGGTAT
CTTGTTGGTCTACGACGTGACGGATCGTGCATCTTTCCAGAGTATCCGAAACTGGGTAGGACAGATTCAGCAGCATGCCGACGTGCACGTGAACAAAATC
CTCATTGGCAATAAGTGCGATATGATGGACGATAAGATCGTTAGCACGGAAGAGGGTCAGGCATTAGCGGAAGAATACGGTGTCAAGTTTTTCGAAACGA
GTGCGAAGAACAATATTAATGTCGAAGGTGGCTTCATTGAGATTGCACGTGAAGTAAAGAACAGGCTCATGGAGGAAGGGGGATCGCATAAGAAGGAAAA
CGTCAACCTCAGCGCAAAACCAGCACCCGTGAAGAAGGGCTGTTGCTAAAGCTTGCAGTCAGTTTGCTACTACATTCTCCACATGCACATGCTGTCTTTG
CGATTACTCACTTCCATTTAATAACTTTTTTCTGATAACGTGAATCATTTTGACGCAAATTCCATCTGTGCAGAACTCTATTTGTTGTCCCATTCTCATG
CCGTCGATGGATATCGTTGCGCGGAATCCACGTGCAAAATACGGATTGGATTGTATACGCCCTTGTATTGTTCACTTCAACAACACGAACAACGCATAGC
TTTAGCAGAGTTGTCGAACGTCAATATTATGGCTCAAACAATTGGTTGCATTCGGTATTGAGAGGGAGATAAATATATTCGTTCCACCAACACAGCGCTG
TACCTCGTCTGCTGTGTTTGCCATTGACAGCTTTGTAACCACCTGACTCAGTGCTTTCATGATCGAATATATCGACGCGATTCTACATTTGGTGGAGCTC
AAGAATAGACTAAACCTGCTACGTACTTTACGGTCAAATGATTGCTGACTATGACGTGGTTAGACTCAGATACTATTGGCACTGGACCTCTGTCACTTGT
CGGATATGAGAGAGCTTATATTGTCGCAAGAACCTCTCATTTGGGTGTCTCGCCTCAATTTGTGGACATTATATTCTTATCGTTGCATTAAGTGAATTAA
CGTAGTTCTTAAGTTTTAGACGCGAAAATTCTCCTGGGCTAATTGATGATAGACGGTAGATCAGGTCGCAGTAATAAGACCCTGTATCCAAAAGTGCCAA
ATGTTATCTACCTAAAATCCATGCTACGTACTACATCCGCTCACATGCGCAGCCCTTGATAGTCTGTGCATTGTGACGTTTTTATATACAAAATGTTGAT
CGATTTTTTTTGTCTACATGGTGACGTCGTGGTCTTCAATTGATCTGATCCAACGGTAATGCAGCTTACGACAAATACTCCTATACCGTGTCAATAAAGA
GTTCCTTAACACGCAGTAGTCAATCAAATACACTTTATTAGTTTCGTCTGTGGATACTATCGTGTCACGAGTAACCAAGAAAAACAATGCGCACTTCGAG
GCGATAAGTCAGGTGCGATAAACGGTTCGAATGCCCCTCGAGATCGGTAGAATGCACGATAGCAAAACGACAGATAAAGGATAGCGTATTGCAAGTAAGA
GGTTGACATTGCAATTGTCACTCATCGACTTTTCCACGGCATCATTCACTGACTAATACAGGCCAAACTTTTTACGGCAAAGCCAGATCTGTGACCTCTT
ATTTCATGGATGCCAATGCTCGATTTAAGCTTCATTGTCTAGCTAATGCTTTTCTGTCCGTGGCTTGCTGTTCTCGACATGTGCGTGTAAATTATAGGCT
TGATAGACCGTGTGCGCTCAAAAACAAGTCTAGGCCTGCGAAAAACGATGTCGTAGATGAATTGTTAGCCACGAGAATGACAAATGAAGGAAAGAGACAC
ACTATGCAAATTGTACAGCTAGCATGGTGGTGGCAAAACGCAAGGAGCTGTAACATGTGATATTTTGTGATAAATAACAGTGGCTGACCATTGGATCATC
GAACCCAGCGTCAGCATGTTGACTCGTCAAGTGACGTCGTATAGATTTCTTGGTGCTGTCAATACTTCCATCACCGCACAGCCGGATTCCAGATTCTATA
GTCTTACATGGCTAAAATTTCAAGTTCTTTATTGGAAACTATCCACTGCTGCTTGACAGGATCTTCTCGTCAGAGCTCATGTGGGCATATTATTTCGGCT
ACTACATCCATCCATTTAATTACCCGGAGGCGTATTTGATCAGCAGCTCACAAGGTAGCTGTATGAAGACATCTTACTGCATTTAGCCCCTTTCACACTC
CATAGAAGATGGTAAAAAAATTGGGTGGTGGAACTGGTGTTGCTAAAGGCGTGTGTGAACATCAGCCTAGATTCATGGGTGATACGATGTAGAGTATTCG
ATTGGTACAGCTTCAAGTCATCAACCTTAGGTCTGTCGTATGCGCCGTGAATACAACACAGAAATTCTTATATCTGGAATGCCGGCTCCAGCGCCTCTCC
GGTGCCGCAACCCTTTGCCACTATAGGTGTGGTATATTGGAGACGGCGATTGATATATCTTTCGACTATGATTTTGCCGCTCAAAGTCTTCATACTTAAC
TCGTCCGTGTTACACACTATTTAAATCGTGTCTTAAAAGGAGACCAGTGCTTATAATTGAAGTGGAGCCTACACTGGATGAGAAACAGGCTGACGGGTAC
AGAATCTTCATGATTTTCAATATCGTTTAGGCGGTTAACCTCCGCTTTCTTTAGATGAATTGTAACGATCTTCGATTTAGTGATGCTGCATTAACCCTTT
AAGGGATTTAAAACCCACTGTTGTTGATCTCTATGCTGAAAAATTTATAAGACTAAGTCAATTGTATTTCAGCCAGTATAATTTTGTACTCAGTCAAATT
CACACTTTATTACCGGCTCTCTAACATTCAACAGATTCGGACTTCGGTGGATTCGGCCTTACTATTCCCAAACGAAATATGTTACCCCTCATAGACTTGA
GCGTCACTCTTCCGTTTATAATAATTTTACCAATTTTTCCATTGACTTCGCGTACTTTATTTTCTAGGTCCCATTAAAGTTACAGAGTCTTTTTACCGTA
CCATTAGCATATGGTAATCTGTATAGCACTATATATGGAAAAGGATGCTACGAAGTCGCGATATCCCTACTCTTGAGAGATTTTTGGGTTTCCCTTTATG
CTTTGCTATTAAATATTCGCATTTAGACTTTTTACTTGGACTTCACCTTTGGCATTTGCCTTTAACCTTTCGCCGTATAATTATTTGGTCGTTAGGGTCT
TCTCTTTCGAAAGTACAGCTTTGTTATAGGTCTCCTTGTGGTCAAGGCTTACGCTGATTTGATTTCCTTATAGCATAGTCAATTTGCGTATTTTTGCCGC
AAATTGACTATGCTTAAATTATTACAGACCCTTAGCGCATCCGACTACTAGAGTTATAGTTATATAACTGGCTACTATTCTAGGACGGCTTTCAGTTCAA
GATCCAAGCTAGCTTAAAGTACGAATTATCGTTTTTTTACCAGGTTCTGGTGGCTACTCCAACACTACAGTAACCAAGGTATTTACCACAGACCATTTAA
CTATGATCTACCCAAGAGTTATAAAATTTCCAATTTTGCCGCCCACGGGGATCTAAACGCCCGTAAACGAGTGTTGGCCGCTACACTACACAGAACTGAT
TAATGCGTAAGTGAAAACGAGATATTAGCGCACGATGTACTTTTTTTATGTATGCCACTCTCACGTATTGACTTTTTGACCTTCCACTTTTTGCTCATGA
TTATCTCTGGTTTGGAGGTACTCGATAACATTTTCTCTCACTCTTTTACGATTTGCATGTATTTTACCTCCACTATATGAGTTTATAGCAATCCCGAAAC
ATGGAGATATTTATTAGTGACAGTGCGCAAGGTAACTGCAGAGCCGTTCAAACCCTACTTCTGTCTGTTGTTGTGTGTCTGTCCGTAAATAATGCTAGGT
GTACCTTATACTTCGTATTAATCCCGATGTAGCACGTCGTCTCCCCGTATGTAGATATGCAGTATATGTGTAACTTGTTGGTCAGGACAGTTACCGCGAC
CGAGAAGTGTGTTAGTTACACACACGCACCATGCCGACCATTACTAACCCAAAAGTGACCAAGGGAGAGCAGAAGGCCTACATCTAATGCTCGATTCTTA
ATGGCAGTTAAACCCCGGCTAGTTTTTGAACTCGTACACCGGAAGTTAGTCCAATTAGATCATTAGCTCACAATCCTCTTCTACGATAAAGCATACTGTA
TTCAGCCAGTGTATTTTTATGGCGGCATCGGTTACGCAAACATATATTGTATTGTAGATGCAGCCGTTCTTCTATGCGGTCACGCTCTTGAACAAGAAAA
TCTATAAAACTTCGTGAGCCGGCGCATCACACCCTACCCCCCCCCCCGAGAGGAATTTGCATTGGCGAATTGTGAAGTTTTGTACTAGGCACCGCCAATG
CGCCAAATGCCGAATGATGTTTCCTTTTCCCAGGTATGCTCGTGACCAGAAAGCCCGTGCCACTTATCGAGACAATCAGGCTGTTCGTTGTAGACACGCT
TCTTGACCAGTGCTACGACGATGCGCAACTCAATGCCATTTTCCTGATCGAGTATCACCGGCACTGTCTAAGAGGTCGGCTTACTACTGAATATCATCGC
GTTCTGGATCAACGGCTCAATAATTCG