Description :
From Genome Similarity Track
Location :
contig_7:71188- 74206
Transcript NameFunction/comments
g2467.t1hypothetical protein
g2468.t1POM60363.1 Spindle assembly protein [Phytophthora palmivora var. palmivora

Sequence
3018 bases(100 bases per row)
TGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTAAATGTCGAGGGCAGCGCCTACCATGACGATGCTATTGATGGC
GACACTGAAGGCAGTGCCTACGTGGAGGTTGACGATGTGAATGAAGGTAGCGCGTACGATGAGGATGATGGGGAGACTGATGGCATCACGTACGAGCAGG
GTGAGGAGGGGAACGATGACAGCGAGGGTGAGGAAGACAGTGAAAGCAGTGCGTACGAGCAGATTAGTGAGCCCGAGCGCAGCGCGTACGGCGATGCCGC
TCTTCAGTATGATGGGGAGATCAACGACAACGTACCGGTAGATGGTGACGACACTCTGCAGATCGGCGGTGATGTCGATACCGGTCTCAGCATCGGCGGC
GACAACGGTCTTTCTCTCGGCGTCAACCTTGGTGGCGGCCTCAATGTCGATGCCGGACTGTCTGCTGGCGTCGATGTCGGCCTCGGTGCCTTCCACGCTG
GTCTCGGCGCCAACGCTGGCCTGAACATCGGTGGCGACACCGAGGTCTCTGCCGGCGCCGACTCCTACCGCCGCCGTCTGCGCAGCAACTAGAACATTCA
TTTCTTCATGAAGTAGTTGCGTTTACGTGTTCAATATACACTTTTCATTTGTCCAACACCGTCTGTTGTATATATGTTGTATATATGAGGTGTAGCACAC
ATTTTGTATTTGAACCAAAATGGAGGAGTTCGACCGCGAGACGCCGCTGTTCGACCGGCGTTTCCACGTGCTGGTGCAGTACCCAGACCGGGACGAGAAG
CTGTTGCCGCTCACTATCCGCCTGCTCACAGGCGTGCGCGTGCGTGTCTTCATCCGCTGCCCCCGCTTCCCTTCTTAGACACAATGCTAATTCTTATTTG
GTCATTTGTGTATCAGCAAAATAATGCCAAGAACCAGAAGGAGCGTGTGATGCGCGTGGAGATGACAGATGACGACGGTGTGGATCCGTACTTCCTGTAC
CTCTGGAGCGTCTCGGAGGAGGAGTTCCACGAGCTCAAGACGCAGCAGCGGCTGCTCGTGGACTTTGCCACGTTCCCCAGCAACCTCATTGAGCTGCTGC
ACTGCTGTCTCAAGGACAGCAAGAAAATTGCTGAAGAAGAAGAAGAAAAAGAGGACAAAGCCAGCGATTTTGGGGAGGAGGAGGCTGCCGTGACGAAGAA
AAGCAATAGTGAGACGAAGCACAGTCAGAAGGCGAGGTCGGCGGGACCAATTCCGTTGAGGTAGGGTGCTGAAGCAATTTGTGAGAGTTCTGTGAGGATG
GCTGATGCTTTTTGTGTGCGGTTTACAGCTATTTGGCGGTGCTGAACACGTCGGATAGCAATGGGCAGTCGGTGTTTAGCATCGTGGAGACGAACCCGTT
CAAGCAGTTGACGCATTTGTCGTTGAGGTTTTTCCCGGGTGATGATGCGGCTATTAAAGCGTATCTTGCAGCGCGGTTGGCGCAGGTTGGAATGAGAAGG
TTGTTGTCGACTTCGCTGAAGCAGACGAGCGAGGAGCTACAGGGGACGCGGAAGAGTGAGACGAAGTTGCAGCAGCAGTTGTCGGCGTTAGGATACGATG
CGGAGTCAACGCTTTCTCAGGAGAAGATGAAGTTTGCGGATGAATTGGATCGGCAACGCAGGACTGCTGCAATGAAAGCGAGGGAGGATGAACTCAATGC
TAAAATTGACGCGCTAGTGGAGAGATACGAGAAAGAGGTAAGCCGCTTTTGCTTCAGGTTGTTCGCAGAGTTGTGTTGTAGCTGTAGACTAATACTTTGT
GCCGAGTAGATTCGAACTTTGAAGGCGGCAGCAGAAGCGAGTGAGGCGCAGGTGCAGGATCTGAGCAAGCTGAAGTACCAGCACGAAATGCAGATCGACA
CCTTCAAGCCCAATCACAGGATCTCAGCCAAGGCAGAAGTACGCTCACAGAGGAAGTGGACGAGCTGCGCACTCAAAACAAACAGTTGGACCAGAAGGTA
TTCCAACAGGAAAAGCAGATTAACGCATTGCAGGTGCGTGCGGACGCGCTGCAGCAACAACTTGCGGACAAGGAGGACGTGATCAAGAAAAGCACAGACC
TTCTCCAGTCGGCAAAACTCCATAACGAGGAGGTCGATGAGTCATTGAAAATGTACCGTGACAACCACGCAAGGCTACAGCAAAAACTGGAGCTGAGCAT
TTCGGAGATCAATAAGGTGAGTGGGCTATGATTCTTACCAGGAGCAAGCAGCTTAGCTCAACCAGCCGTGCCGTGAATTGTGCAGGGAAACGAGATTATC
GAGCGCATCCAAAACGAAAATCGCACACTGAAGTCGAAAATGCGGATGAAGGCCAAGATTATCAAGCAGCAAGAGCAGGTATGATGCCCTCATATTGATG
CTGTCTCAGGCAGAACCCAGACTCTAACGAAACGGATCTACCATCAGTTTGTGGAGGAAAAACAGCTTCAGCGCGAGGAAGCGTTGCTGGAGCTGAAATC
GACGAAGGAAGACATTCGCAAGCGGGACGAACACGTCGCACAATTGAAGGCAGGGACAACCGCATTTGCTCACGTGCATTGTGGCTCCACTCACGTGCTT
TTGACTTATTCTGCAACAGGACACGATCAAGGAACTGAGCCAGAAATTGGAGGACAGCAACAAATTACTGGCATCCAACCAGCAAGGTATAGTTGTAGCG
TGCAGCTCTGTTTCCTTTGGGTTTGTTCTAACCTGAACCTGATGCGCTGTGAACAGTGATCACATGGCTGAACAAAGAGATCAATGAAGCACAGCTCGGC
CACCAGCGGAGGTCGACTGCACACCCTTCCGTGCTCGCGTTCCGTCCGACGGATAAGGTGATAGCCGCAAAAGTCATGACGAACCAACCTCGTCACAGCA
ACTAACCTCCTGTTTGATATGCAACGTATTATCTCGCAGAAGACCGCTACGGAGTCAAGGCCGCCGTCACACTTCGCGAGTCTTCAGTCGTAGCGATAGC
CACTAACTACAGTACCCT