Description :
From Genome Similarity Track
Location :
Scaffold_19:71186- 73924
Transcript NameFunction/comments
Physo_132056reverse transcriptase

Sequence
2738 bases(100 bases per row)
TACCTCTTAAGACGACCCACGAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGG
TCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCGTGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGATAACTAAATCCCCAACCTTAAAC
ACGTTCATGTTTCCGCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCGCCATGGTGTTTCGCACCCTGCTGATTATGTTCAGTCTGT
CTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGCTTTCCGAGCCTCTCCCCCACTTAGGACCGA
AGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGATAAAGGGCGTAAAGCCCGTCGATGCATGTACCGCATTGTTGA
GTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGT
CTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCT
CGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAG
CAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGA
CTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCAAGGCGTGACCGGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTG
GCGACCCACTTGTATACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGCAGCGTCGTGCGC
CTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGACACTATAGTGGAGCAAACCATCAGCCCAC
TCATAGCGGTGCAGCCTTGCATGTTGTCGGGGCGTTAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGCGACTGGCAT
CGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTAGGGTCGGCGCGACAGCGCGTCGGCAAG
CACGTTCAACTTGCTCGGCTTGTACCCGACACAGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCGCTGTGAGAGATGCGGCGTGTTGACG
GCAGTCCACAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGGTGCACTCGGAACTTGACAAGAGCGTACTTCATGGCAAGTAGCT
CCTTGTCGTGGACTGGATAGTTCCGTTCGGATGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCATCGTCGGCCTGCATAGCGCA
CAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCTGTAAGCTCGCTTTGATGT
CGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAAGCCGGTGCCAGCTCGGCGTAGCCTGCACTATA
CTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGATGGTTTTCACCTTCTCCGGGTCCGCC
CAGACCCCGACGCTGCTGACGAAGCAGCCCAGGATCTTGATCTCCTCAGCTGCGAACACACACTTGTCGATGTTGGCGTACAGCTTGTTCGCCCGCATGA
ACGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGGCGAAGATGTCGTCAAAGTACGTCTGTGTGA
ACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGGCATGACCAGCCACTCCCAGAGCATACC
GCTCGGCGTGCTCACAGCCGTGAGTGGGACGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAGGTCCAGCGCGCTATACAGCGTGCAGCCG
ACCCTGTTGCTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGCCCAGCTTGTTATAAGCATGAACCAGACGCCACTTTC
AATTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCGGGGGCTTCGACTCCCGCACCATGCCTGCCTTCGCCTTGGCGGCAAAGAAGGCATCAATGAC
TTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTCGTGCCTGATTCCCCTGTCCGGAGGGAGA
TTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTC