Description :
From Genome Similarity Track
Location :
Scaffold_324:7118- 13415
Transcript NameFunction/comments
g7809.t1XP_009534708.1 hypothetical protein PHYSODRAFT_361865 [Phytophthora sojae
g7810.t1hypothetical protein
g7811.t1hypothetical protein

Sequence
6297 bases(100 bases per row)
CGAACTCGTCCAGCGCCGCCGTCAGCTGCTCGTACAGAGCGTCGTTGAAGGCGTTCTTGGCGCGAGGGCGGTGCATCTCGGCCACGTAGATGCATCCGGC
GTGCACGTAGCGACGGACCATCGTCGCATGTTGCTGGTTGCTCGTCATGGCTGCTGAGCGGTTGCGCACTTGACGACCGATTTGATTATGTTAAACCGCA
AGATTTGCGTTGAAGCTCGGAAACGTCGTTGAGTCGACAATTTGGAGATTGGAGACACAGATCGAGAGATCTCCAAGCTTCCCACGAGCAGAGCTCGCGG
GGACAAGCGTGAGCACAGCTCACGCTCCGACGACATGTACTTTACCAGCGGCGCCGACATGAAGGGGACTGCCGCCATTCTTGGGCGATGGCTTGGTTTG
CCCTCGCAGACCTTGTCGTGGTTAACCCCTCAGTTCCCAGACTATTTACGAGGTATATATTTCGAGTCTGTCCCATATTATAATATATAGGGATTTGTAA
AGGTCATCGCTTAAGTTCGAATTTTGAGGTGCGGGTTGGGGGAGGGCATAAGTCTGAGCTAGTGACTACACTCCTGGCCAAATTAATCCGGCCACCCACC
TATTTGACCGTAGCTCAGCCAATTCTACAGATATGGCCCTGCGGTTTTGATATGTGTTTTGTATAGTACAGAGAAGCACAGTGTTTGTGTTAACAATTGC
GGTTTTGCGGTTTGTGCGGTAGCTCCCATACAATACACCGTTTTGGGTATGCGGTCCAAACTTCCGGCCACCCGAGCCCATATTAAAATGAAGATATATG
TAACGAAAAGATTGTATTAGTAATGCGTTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTCGAGGCATTGAATCTATGAGCGTCGTTAGCGCAGC
TTGATCAATGTTTTTCCACGCCGTCAATATACACTCCTGGCCAAAAGTATACGAACACCCCTACTTTTACGAATAACTCGGCTTCTAGCCAGAGTTGAAG
GCTGCGCGTTGGATATGTTTTGTGAAATACTGTAAGCGTTTGTTGGTTTGGACTAACGCTGCGGATTTCATCTTCTGCTAGGTACCTCACATACAAAAAA
CCACTTTTGGCTGGTGGCCAAAATATACGAACAGAAAGCACTGAACAACATCCCATACAAATTCCTATATTGATGATGGGTGCAGGAATGATGGTAACTA
GTAGTGGGTCTTGTTGCCCTTCCTTTCGATGACTTCGATGCACCTGCGAGGCATGAAATTGATCAGCGTCGAAATAGTCTCCGCAGATATGTTGTCCCAG
GCCGTGTGCAGTGCCTTCGTCAGAGAGGTCACGCTATCGTATTGCCTTCCATTGCGGTAAACATCCCGGGACATGATTACCCAGAGGTTTTCGATTGGAT
TAAGGTCGGGCGATCTTGCAGGCCAATCCATCACTTGCACGCCTTGCTCTTCAAAAAAGGCATTCGTCTCCCGCGAGGTGTGTATAGCAGCGTTGTCCTG
CTGGAACACGAAATCTACTCCGTAGTGTAGGTGGGCGAAAGGAAACAAGTATTCTGGCACTGTGTAGATATAGTGTTCAGAAGCTTGCCTACCAACGAGC
ACAGCTAGCTTGGTTTTCCCGGCGGTACTGAAGCCACCCCACACCATCACGGACCCACCACCCATTTGCCGCCTGTTTGTTTGGCCGGGAGGCTGGCACA
GATCTCACCAGTAGTTCTGGAGGCCATCAGGGCCGTCCAGGTTCCACTTCTTCTCGTCAGAAAAGATGATCTGCGCCCAGTCGTCAGGTCGGATGACCAT
TGCCTTCGCCCATTTGAGCCTGGCCGCCTTGTGGGCCGCCGAGAGCTGCACCGTATTCTCCATCTTGGAGTAGACTAGCCAGTCTACTGCCGAGATGGAG
CGTCGAACCGTGCGTGTGGAGCAGTTCAGCGACAGCTGGTCCCTTAGCTGGATCGACGAAAGCTCTCACTTGGCAGCCGTACGAACGAGGCGCCGCAGCG
TTCTCTCAGACAGTACTTGAGGCCTCCCTAGTCTTGCTTCTTCTCGTTTAGGGTTCTTCGAGCGTCGAATAACGCGCAGAACAGCGTCTGGCGAGTGGTG
CGTCTTGCCAGCGATGGCGCGAACTCCGACTCTAGCTTCGTGCAGCCCTTGGATTCTTCCCTTCTCTTCGTCAGCCAGCAGATTGCCCTTGCCCATCAAT
TCGAGAAATGAGCGCAACGAGCGGTGCCCCCTGCGTCCCAGCCTGCGACCATCACGGGCCATTCAAATTTTTCACGTCAAATGTATAGGAATTTGTATGG
GATGTTGTTCAGTGCTTTCTGTTCGTATATTTTGGCCACCAGCCAAAAGTGGTTTTTTGTATGTGAGGTACCCAGCAGGAGATGAAATCCGCAGCGTTAG
TCCAAACCAACAAACGCTTACAGTATTTCACAAAACATATCCAACGCGCAGCCTTCAACTCTGGCTAGAAGCCGAGTTATTCGTAAAAGTAGGGGTGTTC
GTATACTTTTGGCCAGGAGTGTATATTGACGGCGTGGAAAAACATTGATCAAGCTGCGCTAACGACGCTCATAGATTCAATGCCTCGACGCTGCATTGAA
GTGATTGAGAAGAAGGGTGGTAAAACGCATTACTAATACAATCTTTTCGTTACATATATCTTCATTTTAATATGGGCTCGGGTGGCCGGAAGTTTGGACC
GCATACCCAAAACGGTGTATTGTATGGGAGCTACCGCACAAACCGCAAAACCGCAATTGTTAACACAAACACTGTGCTTCTCTGTACTATACAAAACACA
TATCAAAACCGCAGGGCCATATCTATAGAATTGGCTGAGCTACGGTCAATAGGTGGGTGGCCGGATTAATTTGGCCAGGAGTGTACCACTCCGTTCCGTT
ATTATAGATGGCACGGACTCTTCCGACTCGGGATTCGTAAAAACTGAGTTGATTTGGCTTCTATTGGTAGAAAAAGAAAGCTCACGCTGAGCTCTTTTCA
TTGGTGTGCTGCCAGCTCGGCAGCGCATTGTTCTCGAGCAGTGGCTGCAAAATGAGTGGTTCGGACGACCAAAATAGCGTGATGTGTCGCCCATCCGCAT
ATCCCTCCCCCACGCTGACAGTCTAAACTCTATCATTCGACATTTGACATTGTCTCACGCATCCACTAAACCCCCCTTTGCCAGCAACTCCCCCAGCAAT
GAGCACCGCGCCCACCCTCAAGCCCAAGAAGAACATGACGGACGACGAACGCGCCCAGGTCGTCACAGCCGTACTGGCGCTCTCGTCGAATGGCGTCCCC
AAGATGGGGGCCTTCGTCGAAGTCGCCACCAAGTTCCCCTTCACGGTGATCACCGTGCGGCGCGTCTGGCACCGCGCCGACGAGAACGCCAAGGCCAACG
GCACCTACACCTCCACATCGCGTATGAAAGGTCGCTGCGGCCGGCACGAGACGGATCGCAGTGCAGCGTTGGAGCGCCTACAAGCCGTACCGCTCACCCA
GCGATCCACGATTCGGTCCGCAGCCGCAGCGTGTGGTTTGCCCCCACCTCCCTCTACCGCCGCTTGCAAGCAGGGCTCCTCCGTCCGGCAGTCAGCGTCG
TCAAGCCTCAGCTCACGGACGACAACAAGATCACGCGACTCCGCTACTGCCTCGGCCACGTAGACAGAACTTCTCGTCTCTTTGACGAGATGTATGACGT
CGTACACGTCAACGACAAGTTCTTCTACGTGACCGAGGTCAAGAAGCGCTTCTACCTGTTGCCGGACGAGGATGTGCCGTACAGGGCCCTGAGAACAAGG
CGGAACGTGACCTAGGTGATGTTCTTGGCCGCTGTGGCCAGGCCGAGATGGGACGCAGCCACCGGCACTATGTTTGGCGGCCTTCTCGGCATTTGGCCGT
TCGTCGAGCGCCGCCCGGCGCAGAGGTCGAGTTGTAACCGACCCGCGGGAACGATGGAGACGGAAAATGTGTCCGTGGGGAAGGATGCGTACCGCGCTAT
GCTGATCCAGCACGTACTTCCCGCCATTTGCGCGAGGATGGCGTTGCCGCCGCACGGCGGCTCAATCACGATCCAGAAGGACAACGCCCCTCCGCACATC
GGCCCGACCGACCCGCAGTTCAGCCAAGCCGTGCTGAGTTTTGGGAGAGACGTTGCCCTGCGGTTCCAGCCGCCAAACAGCCCAGATCTCAACTGTTGTG
ATCTTGGCTGTTTTCAGCCGTCCAAGCCCGCCAGCGCCAGCACCAGACTCGCACCATCGACGAGCTAATCGAAGCCACTGGCTTCTTTCTGGGAGCTACC
CCCTTCGACTGTCTACGCAGCCTTCCTATCGCTACAATGCACAATAGACGGGTGTATTCGTGCAAAAGGGGGCAACGACTATCGCATTGCCCACATGGCG
AAGGCTAAACTAGAGCGGGAGGGAAGACTTCCCGAGAGCATTAAGTGCAGCTATGTACCCGACTCGTTTGTGCACATGATGACTGACAGATAGACAGATT
CCATACTAAAATCAAATACAGGTTCAGTGCTATTTTTCCGGAACAACGTAAAGAGTGGTACCATGCTATAATAACGGAACGGAGTGGTACACCTTTGCCA
GTGCAATATGAGACTGTGCCAGAGCAATGCGAAATGGTTGAAAGTAATTTAACCAAGATAGTTACATTACGTCATTTATATCACTGGCTCTGAAGCAAAT
AGATTAGTGCCAGAGCAAGCGAGACCAACCAGGGCCTCCTTCATTTTCCAATCTACCGACCCGACCACCAGCCAGTATGCCTCGAGCCCCAAGTCGCCGA
TCTTCCACGACCCCGCCCCGTCGTACCGCGACCGCGGCGGAGCGTCAACGCGTGCTGGACGCGTACGGGGCAGGTGACGACTGGCTAATGGTGGCAAGGT
ACAACAACGTGTCGCGTGCTGCAGCATACCGGCTGTGAAAGTCGGGGAATCCCAGTCTGCCGCGGAGAGGAGGTGCTCGCACCACCTGCGTGAAGTGCAC
GGATGAGGTGGTGGCGGCGCTGGAGGGATACCTTGAAGACGACTGCACTTTGACGCTTGTGCAGCTTCAAGACAAGATCATGGAGCACTTCAAAGTGGAT
GTCTCTACATCTACTATCAGCGCGAAGCTTGTAAGCAAGCTAATTACGTTGAAACAGGTACAAACTTGCTGCATTTTATTATTAACTTTACAGATTTTTT
TTTTCGTTTGTTCATCTGGAATTGTTTATTGTATTGGTGATATATGTGCGTGCTTTAGATTCGCAAGGAACCAACCACATGCAACAATGAAGTAAATAAA
GTTAAGCGGTTCAGGTTTGCTACTGAACTCGTAAGTCACCAAGCCAACGGTGAGTACATTGTGTACTATGACGTTTCAAATTTCAACCTTATCTGGATGC
GCACCCAAGGACGTGCCCCAGTCGGCAAGAGAGCCGTCGTCAAGACGCCCCCGTCAAAGGGAAAGAACCTACATCTACAATGTGCAGTGATGGGTTCGCA
TCGAAGCACGACGGAAGCGAGGATGTTGCTGCTCGAGGATGCTGCCAACGCGTCGATCGGCTGCACAAATTGTCACTTGATCGTGTCGATGGCACTGCAC
TGCCAGCGCGCTGTCGCGGGCGCGTTAAAGCTAGAAGACATGGAGAACGGCGCTTAGTTGTGGTAGTTTACTAACATGCAATCTCATTTGCCCTGGAGCA
AATATCGTTTGCGTGGGCGGCACCCAATTTAAATTTTAAATTTTGGGCCCAAATTAAAAAGCCGCAAACAATCCCAGTTTTCTTTCCGTTCTGTCTCCTA
TTGCACTGGCAAAGGTGTAGAGTGCTAGCACATCCAACTTATGAGTCTCGTATGTTCGTTGAGACGCGCCTATTTCATCACTAATGTCGGCAATGTTAAT
ATAAAGACTGTACTGTTTATTTGGGTGCCTCATTTTTGAAGCGTTGCACACGACCACCAGCACTGGATGTACCGTTGAGCTCTACATTTGACCAATGCAA
AGAATGCAAATGCCTCGTCTCCATTGATTGCAAATTATCAAGAGATATACAGACGTGTCATTTCTCCCCTCCTCGTCACCAGCCTGCTCACTTCCTGTGT
CTCCCTCGCAGTTAGCTTCCGAGTTTTCCATCGCCGCTAGCTTCCGAGTCGTCTCCAGCTCTGTGTGGCGTGTCACAGTGTGCCTGACCACAGCAGCGCC
GCTTCTTGTTCGGCCGCGAAGGTGGAGCTCGGTCGCAGACCTTGTGGTCCTGCAGAATTAGTCGTGGAATGTCATTGCCGTTGCTTCAATCCTGATG