Description :
From Genome Similarity Track
Location :
contig_50:71176- 72786
Transcript NameFunction/comments
g9897.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1610 bases(100 bases per row)
AGCGCGTCGGCCACGACATTCAACCTTCCACGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGT
GCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAAACTTTGCGAGTGCATACT
TCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCGCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATC
GAGTTGCATCAGTGCGCATCCGATCGTGAAATCGGACGCGTCGCACACAACGTGGAATGGGCGATCTTGGTCGACCACCGCCAAGATCGGCGCCTCAGTC
AAACCCGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGC
GTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCTTGTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACC
TTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCT
TGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTTCACATTCGATCTCCCATTCACAGCCCGGCTGTGAATGAACACGTCATC
GAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGC
CACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTAC
TGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCGTTTCGAGGTATCGGCGTCTGCGCCGGTACCGCCGCATCGTTCAGCTTGTAATAAGCATG
AACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCCTTGCGACGACTTTCA
AAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACAC
CCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCC
TTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCACAGATGAGCTGATCCAGCTCTTTTGCTTCACACGTCACCCTCTCC
ACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACACTA
ACGTCGGAGG