Description :
From Genome Similarity Track
Location :
contig_7:71171- 74189
Transcript NameFunction/comments
g2322.t1hypothetical protein
g2323.t1OWZ03741.1 Spindle assembly protein [Phytophthora megakarya

Sequence
3018 bases(100 bases per row)
AACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCGAGCTAAATGTCGAGGGCAGCGCCTACCATGACGATGCTA
TTGATGGCGACACTGAAGGCAGTGCCTACGTGGAGGTTGACGATGTGAATGAAGGTAGCGCGTACGATGAGGATGATGGGGAGACTGATGGCATCACGTA
CGAGCAGGGTGAGGAGGGGAACGATGACAGCGAGGGTGAGGAAGACAGTGAAAGCAGTGCGTACGAGCAGATTAGTGAGCCCGAGCGCAGCGCGTACGGC
GATGCCGCTCTTCAGTATGATGGGGAGATCAACGACAACGTACCGGTAGATGGTGACGACACTCTGCAGATCGGCGGTGATGTCGATACCGGTCTCAGCA
TCGGCGGCGACAACGGTCTTTCTCTCGGCGTCAACCTTGGTGGCGGCCTCAATGTCGATGCCGGACTGTCTGCTGGCGTCGATGTCGGCCTCGGTGCCTT
CCACGCTGGTCTCGGCGCCAACGCTGGCCTGAACATCGGTGGCGACACCGAGGTCTCTGCCGGCGCCGACTCCTACCGCCGCCGTCTGCGCAGCAACTAG
AACATTCATTTCTTCATGAAGTAGTTGCGTTTACGTGTTCAATATACACTTTTCATTTGTCCAACACCGTCTGTTGTATATATGTTGTATATATGAGGTG
TAGCACACATTTTGTATTTGAACCAAAATGGAGGAGTTCGACCGCGAGACGCCGCTGTTCGACCGGCGTTTCCACGTGCTGGTGCAGTACCCAGACCGGG
ACGAGAAGCTGTTGCCGCTCACTATCCGCCTGCTCACAGGCGTGCGCGTGCGTGTCTTCATCCGCTGCCCCCGCTTCCCTTCTTAGACACAATGCTAATT
CTTATTTGGTCATTTGTGTATCAGCAAAATAATGCCAAGAACCAGAAGGAGCGTGTGATGCGCGTGGAGATGACAGATGACGACGGTGTGGATCCGTACT
TCCTGTACCTCTGGAGCGTCTCGGAGGAGGAGTTCCACGAGCTCAAGACGCAGCAGCGGCTGCTCGTGGACTTTGCCACGTTCCCCAGCAACCTCATTGA
GCTGCTGCACTGCTGTCTCAAGGACAGCAAGAAAATTGCTGAAGAAGAAGAAGAAAAAGAGGACAAAGCCAGCGATTTTGGGGAGGAGGAGGCTGCCGTG
ACGAAGAAAAGCAATAGTGAGACGAAGCACAGTCAGAAGGCGAGGTCGGCGGGACCAATTCCGTTGAGGTAGGGTGCTGAAGCAATTTGTGAGAGTTCTG
TGAGGATGGCTGATGCTTTTTGTGTGCGGTTTACAGCTATTTGGCGGTGCTGAACACGTCGGATAGCAATGGGCAGTCGGTGTTTAGCATCGTGGAGACG
AACCCGTTCAAGCAGTTGACGCATTTGTCGTTGAGGTTTTTCCCGGGTGATGATGCGGCTATTAAAGCGTATCTTGCAGCGCGGTTGGCGCAGGTTGGAA
TGAGAAGGTTGTTGTCGACTTCGCTGAAGCAGACGAGCGAGGAGCTACAGGGGACGCGGAAGAGTGAGACGAAGTTGCAGCAGCAGTTGTCGGCGTTAGG
ATACGATGCGGAGTCAACGCTTTCTCAGGAGAAGATGAAGTTTGCGGATGAATTGGATCGGCAACGCAGGACTGCTGCAATGAAAGCGAGGGAGGATGAA
CTCAATGCTAAAATTGACGCGCTAGTGGAGAGATACGAGAAAGAGGTAAGCCGCTTTTGCTTCAGGTTGTTCGCAGAGTTGTGTTGTAGCTGTAGACTAA
TACTTTGTGCCGAGTAGATTCGAACTTTGAAGGCGGCAGCAGAAGCGAGTGAGGCGCAGGTGCAGGATCTGAGCAAGCTGAAGTACCAGCACGAAATGCA
GATCGACACCTTCAAGCCCAATCACAGGATCTCAGCCAAGGCAGAAGTACGCTCACAGAGGAAGTGGACGAGCTGCGCACTCAAAACAAACAGTTGGACC
AGAAGGTATTCCAACAGGAAAAGCAGATTAACGCATTGCAGGTGCGTGCGGACGCGCTGCAGCAACAACTTGCGGACAAGGAGGACGTGATCAAGAAAAG
CACAGACCTTCTCCAGTCGGCAAAACTCCATAACGAGGAGGTCGATGAGTCATTGAAAATGTACCGTGACAACCACGCAAGGCTACAGCAAAAACTGGAG
CTGAGCATTTCGGAGATCAATAAGGTGAGTGGGCTATGATTCTTACCAGGAGCAAGCAGCTTCAGCTCAACCAGCCGTGCCGTGAATTGTGCAGGGAAAC
GAGATTATCGAGCGCATCCAAAACGAAAATCGCACACTGAAGTCGAAAATGCGGATGAAGGCCAAGATTATCAAGCAGCAAGAGCAGGTATGATGCCCTC
ATATTGATGCTGTCTCAGGCAGAACCCAGACTCTAACGAAACGGATCTACCCATCAGTTTGTGGAGGAAAAACAGCTTCAGCGCGAGGAAGCGTTGCTGG
AGCTGAAATCGACGAAGGAAGACATTCGCAAGCGGGACGAACACGTCGCACAATTGAAGGCAGGGACAACCGCATTTGCTCACGTGCATTGTGGCTCCAC
TCACGTGCTTTTGACTTATTCTGCAACAGGACACGATCAAGGAACTGAGCCAGAAATTGGAGGACAGCAACAAATTACTGGCATCCAACCAGCAAGGTAT
AGTTGTAGCGTGTAGTTCTGTTTCCTTTGGGTTTGTTCTAACCTGAACCTGATGCGCTGTGAACAGTGATCACATGGCTGAACAAAGAGATCAATGAAGC
ACAGCTCGGCCACCAGCGGAGGTCGACTGCACACCCTTCCGTGCTCGCGTTCCGTCCGACGGATAAGGTGATAGCCACAAAAGTCATGACGAACCAACCT
CGTCACAGCAACTAACCTCCTGCTTGATATGCACCGTATTATCTCGCAGAAGACCGCTACGGAGTCAAGGCCGCCGTCACACTTCGCGAGTCTTCAGTCG
TAGCGATAGCCACTAACT