Description :
From Genome Similarity Track
Location :
scaffold_7:71132- 74146
Transcript NameFunction/comments
g8413.t1hypothetical protein

Sequence
3014 bases(100 bases per row)
GGCCAGGGCGAGCTGACCGGCAGCCTGAACGGTGGCGTGAACGGAGGTGCCAATGGCGAGGTCAGCGGAAGCTTGAACGGCGGTGTCAACGGCCAGGGCG
AGCTAAATGTCGAGGGCAGCGCCTACCATGACGATGCTATTGATGGCGACACTGAAGGCAGTGCCTACGTGGAGGTTGACGATGTGAATGAAGGTAGCGC
GTACGATGAGGATGATGGGGAGACTGATGGCATCACGTACGAGCAGGGTGAGGAGGGGAACGATGACAGCGAGGGTGAGGAAGACAGTGAAAGCAGTGCG
TACGAGCAGATTAGTGAGCCCGAGCGCAGCGCGTACGGCGATGCCGCTCTTCAGTATGATGGGGAGATCAACGACAACGTACCGGTAGATGGTGACGACA
CTCTGCAGATCGGCGGTGATGTCGATACCGGTCTCAGCATCGGCGGCGACAACGGTCTTTCTCTCGGCGTCAACCTTGGTGGCGGCCTCAATGTCGATGC
CGGACTGTCTGCTGGCGTCGATGTCGGCCTCGGTGCCTTCCACGCTGGTCTCGGCGCCAACGCTGGCCTGAACATCGGTGGCGACACCGAGGTCTCTGCC
GGCGCCGACTCCTACCGCCGCCGTCTGCGCAGCAACTAGAACATTCATTTCTTCATGAAGTAGTTGCGTTTACGTGTTCAATATACACTTTTCATTTGTC
CAACACCGTCTGTTGTATATATGTTGTATATATGAGGTGTAGCACACATTTTGTATTTGAACCAAAATGGAGGAGTTCGACCGCGAGACGCCGCTGTTCG
ACCGGCGTTTCCACGTGCTGGTGCAGTACCCAGACCGGGACGAGAAGCTGTTGCCGCTCACTATCCGCCTGCTCACAGGCGTGCGCGTGCGTGTCTTCAT
CCGCTGCCCCCGCTTCCCTTCTTAGACACAATGCTAATTCTTATTTGGTCATTTGTGTATCAGCAAAATAATGCCAAGAACCAGAAGGAGCGTGTGATGC
GCGTGGAGATGACAGATGACGACGGTGTGGATCCGTACTTCCTGTACCTCTGGAGCGTCTCGGAGGAGGAGTTCCACGAGCTCAAGACGCAGCAGCGGCT
GCTCGTGGACTTTGCCACGTTCCCCAGCAACCTCATTGAGCTGCTGCACTGCTGTCTCAAGGACAGCAAGAAAATTGCTGAAGAAGAAGAAGAAAAAGAG
GACAAAGCCAGCGATTTTGGGGAGGAGGAGGCTGCCGTGACGAAGAAAAGCAATAGTGAGACGAAGCACAGTCAGAAGGCGAGGTCGGCGGGACCAATTC
CGTTGAGGTAGGGTGCTGAAGCAATTTGTGAGAGTTCTGTGAGGATGGCTGATGCTTTTTGTGTGCGGTTTACAGCTATTTGGCGGTGCTGAACACGTCG
GATAGCAATGGGCAGTCGGTGTTTAGCATCGTGGAGACGAACCCGTTCAAGCAGTTGACGCATTTGTCGTTGAGGTTTTTCCCGGGTGATGATGCGGCTA
TTAAAGCGTATCTTGCAGCGCGGTTGGCGCAGGTTGGAATGAGTAGAAGGTTGTTGTCGACTTCGCTGAAGCAGACGAGCGAGGAGCTACAGGGGACGCG
GAAGAGTGAGACGAAGTTGCAGCAGCAGTTGTCGGCGTTAGGATACGATGCGGAGTCAACGCTTTCTCAGGAGAAGATGAAGTTTGCGGATGAATTGGAT
CGGCAACGCAGGACTGCTGCGACTGCAATGAAAGCGAGGGAGGATGAACTCAATGCTAAAATTGACGCGCTAGTGGAGAGATACGAGAAAGAGGTAAGCC
GCTTTTGCTTCAGGTTGTTCGCAGAGTTGTGTTGTAGCTGTAGACTAATACTTTGTGCCGAGTAGATTCGAACTTTGAAGGCGGCAGCAGAAGCGAGTGA
GGCGCAGGTGCAGGATCTGAGCAAGCTGAAGTACCAGCACGAAATGCAGATCGACCACCTTCAAGCCCAATCACAGGATCTCAGCCAAGGCAGAAGTACG
CTCACAGAGGAAGTGGACGAGCTGCGCACTCAAAACAAACAGTTGGACCAGAAGGTATTCCAACAGGAAAAGCAGATTAACGCATTGCAGGTGCGTGCGG
ACGCGCTGCAGCAACAACTTGCGGATAAGGAGGACGTGATCAAGAAAAGCACAGACCTTCTCCAGTCGGCAAAACTCCATAACGAGGAGGTCGATGAGTC
ATTGAAAATGTACCGTGACAACCACGCAAGGCTACAGCAAAAACTGGAGCTGAGCATTTCGGAGATCAATAAGGTGAGTGGGCTATGATTCTTACCAGGA
GCAAGCAGCTTCAGCTCAACCAGCCGTGCCGTGAATTGTGCAGGGAAACGAGATTATCGAGCGCATCCAAAACGAAAATCGCACACTGAAGTCGAAAATG
CGGATGAAGGCCAAGATTATCAAGCAGCAAGAGCAGGTATGATGCCCTCATATTGATGCTGTCTCAGGCAGAACCCAGACTCTAACGAAACGGATCTATC
CATCAGTTTGTGGAGGAAAAACAGCTTCAGCGCGAGGAAGCGTTGCTGGAGCTGAAATCGACGAAGGAAGACATTCGCAAGCGGGACGAACACGTCGCAC
AATTGAAGGCAGGGACAACCGCATTTGCTCACGTGCATTGTGGCTCCACTCACGTGCTTTTGACTTATTCTGCAACAGGACACGATCAAGGAACTGAGCC
AGAAATTGGAGGACAGCAACAAATTACTGGCATCCAACCAGCAAGGTATAGTTGTAGCGTGCAGCTCTGTTTCCTTTGGGTTTGTTCTAACCTGAACCTG
ATGCGCTGTGAACAGTGATCACATGGCTGAACAAAGAGATCAATGAAGCACAGCTCGGCCACCAGCGGAGGTCGACTGCACACCCTTCCGTGCTCGCGTT
CCGTCCGACGGATAAGGTGATAGCCACAAAAGTCATGACGAACCAACCTCGTCACAGCAACTAACCTCCTGCTTGATATGCACCGTATTATCTCGCAGAA
GACCGCTACGGAGT