Description :
From Genome Similarity Track
Location :
contig_93:71126- 73107
Transcript NameFunction/comments
g12695.t1hypothetical protein

Sequence
1981 bases(100 bases per row)
GGCGCCGAGGATATGTGCGCGCTGGGCCACCTACACGAACCCGCGATCGTGTACAACGTGCGCGAGCGCTTCTACGCCCAGGAGCCGTACACGTACACGG
GCAAGATCGTGGTGGCCGTGAACCCGTACCAGTGGCTCAAGAAACTCTACTCGGAGGAGCTGCGCGACCAGTACACGCAGACGCCGTGGGACGAGATGCC
GCCCCACGTGTACGCAACGAGCGCCGAGGCCTTCCACCACATGAAGCAGCACCGCATGCCGCAGAGCATCTTGGTGAGCGGCGAGTCCGGCGCGGGCAAG
ACCGAGACGGTCAAGATTATGATGGAGCATCTGGCCAGCATCTCCATGGGCATGGCCAAGCGCCTGCACCCCACGGAGAGCGGAGAGACGATTGTGGTGG
AGAAGGTGCTCAAGAGCAACCCGCTGCTGGAAGCCTTCGGAAACGCCAAGACCATCCGCAACGACAACTCGAGTCGCTTCGGAAAATTCACGCAGCTGCA
GTTCAATAACGAGCTCTGTCTTGTAGGTGCCGAGTGTCGCACTATTTGCTCGAGAAGTCGCGCGTGGTGGCGCAGGCAGCGGGCGAACGCAACTACCACA
TCTTCTACCAACTTGTGAGCGCCAAGGAGGATATCTTTGGCTTCAGTGATGACTCGTCCGCGAGCGAGTTCAGGTACCTGCAGGACGAGAAACTCATTCT
GGACGGCCAGACGGACCTTGAACGGTACCAGGTCACTCGTGATGCGCTGAGTACCATTGGGCTCAGCGACGAGGAGCAGAACCAGCTCTTCAGTGCTCTC
TGCGGTATCTTGCGTCTGGGCCAGCTCGACTTTGTTCCTTTGGAGTCAAACAAGGACGATGCCAGCCAGGCGGTTGCTTCGTTGAATGCGTCAGCGACTT
CTGCCCCTGTCACTGCGGAGCAGATTGAACAGCAGAAGATGGAAATCGAGCAGTGCGCGAAGCTGCTGGGTGTGGAAGTGACCGCGTTGAGCAAGCAGCT
CTGCAGCCGTACCGTCAAGGCGCGCCAGGAGGTGTACTGCGTCCCGCTGTCAGCTCTGCATGCCGGCAACAATCGTGACGCTTTAGCGAAGGAGATCTAT
GCGCGAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGC
TGGATATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGT
GTTTAAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCG
ATGGGCGTGATGGCACTGCTGAACGAAGAATGTGTGCGCCCCATGGGAAGTGATTTGTCATTTGTATCGAAGCTTGTGTCACTGCGCGAGTCACATCCAC
GTCTTGAGCGAGCACGCCTCAGTCAGACGCACTTCATGCTGCACCACTATGCGGGCCCCGTGACATACGACGCGGAAGGCTTTGTCGAGAAGAACAAGGA
CTCGTTGCAGACTGATCTACTGGAGCTGCTTGGTACGAGCTCAAATGGCTTGCTGTCGATGGTATTCGGCGACGACAACAACACAGCATTCATGACAGAC
GCGGATCTGGCTGTCCGTGCGGCAACCATGATGGAGTCGGGACGACGCAGTACTGTCGGACGGAAAACGTCAACCTTCATGCAAGAGACCGTGAGCTACA
AATTCAAAGCACAGTTGTCGCTGTTGATGAGTGACATTTCCAGCACTGAGGTGCACTATGTACGTTGCATTAAACCCAACTCGCAAAAGAGCCCGAGTGT
CTACGAGATCGATGCGGTTGTGAACCAGCTTCGCTGCGCCGGTGTCGTTGAGGCCATCCGTATCACACGCGCCGCATTCCC