Description :
From Genome Similarity Track
Location :
Scaffold_389:7112- 12257
Transcript NameFunction/comments
Physo_125777hypothetical protein

Sequence
5145 bases(100 bases per row)
GGCCTGCGAGTTGGGAGCCCACGAAGCATCACCGTCAAATCAAGATTGTCAACGAGGTGAAGGCATGCTAGTACATGAGCACACAGCCACCTCGTCTGGT
AGAAATCTTTGCAGTCACACTTGAATTTTTTTCTGATGGTGTTGATCTCCTCCAGGGACCACAACGGAGAGTTCCAGTCGTGCTCATACGGAAGTCGATC
CAACACCGCCACCTTGTGCAGTGAGAGGTATCGAAACTGGACATTCTCCACAATTTCATCATCCTTGAGGGATCCGCTGACCGATCTCTCATAGGTCTTT
GTTCGGCTCGCGTTCACCTTCAATCCATGCACATTGTCGTCCCGGACGATGTAGTATCTCTGGTTGAAGTAATACGCCTGGATGTTGCGGATTGCTCTGC
GCGACTTGCGTTTGTGAGTCGGGATGTAACGGGGTTACACGCAAAAGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAGAGGTTTGAA
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGTCTACATACATTTAAGACCACCACGACGGGTGGTCTATACACAGTTAGGATTCCTATTGGCTGAAA
GCAGTATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGGTTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAAAAATAGCAGTTCTCATTTTGACCCAAAAACATTATTTGGATCATTTATTTAGATTAATCTATACTCGGAGGTCCGAGTATAGATT
AACTCTAGTCTAAACTAAGCTACGCTTCCTCGTACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACGGGAAGTGGTTGT
CGTCGTTGCAGAGGAGTACACCAGCTTCTAGAACCTCTGCGGAAACTGGCCCAGCGGCAAAGTGCTGGATAGGCTCCGACCCAATTCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTTCTAGATGCTCTATTGTGTAGACCATCACGCGGAAAGGTTTGCTCGCGAAACTGCCAC
GTGTTGCGAAAGCAGTGGTGTCGAGACATCGGTCCGTGTCGAGACAAGCTGTGCCAGCGCTGGCATGAAGTCGATGCTCACGTCTGGCGCTGTCAAAACA
CACACTGTGAGTACTCCATCCAAGTCAAGCTACGAGAGTCGATGCACCAAATTGAGCATCAGCATGAGCGAATCGACAGTGTGCGAAGGGAACTCGATGA
GAGAAAGAAAGAACTGACCGAAGCCAATGCTTCTCGATTGACCAATCCGCCAAGCAAAATTTCTTTCTTAAGCAAGCAAGTGGACTTGCTTGAACGAGAA
TTAAGAAGCGAGCAAGAGCAGCTGGAATTTTATCAGTCTTTGGAGAGAGGGAATCTTGAAGCTGCAGAAGAAGCCGACATCAACCCACTAGCTGGGGACT
TCCAGATGCATTACATGGTGAAAACACGGGGTGAAACCGCTGCAATAGATGATGGAGTGCGCACGAAAGAAGATACGAACCAAGTGGTTCCAGCTCGCCG
ACCAGTCATCGAAAAGGATGAGCTATTGCCTTCGTTGGCTGACCCGATTGGAAAGCTTTGCTACGCAGGGCAGCGTACCGCGGATGTTCAAGGAGTGTCT
GCGGAAGTCCATTAGGTTTATTGATGCCTTACTATGCAAGCCACCTCATGGTAAAGTCTGCGTACGGGATTGCAAGATGATTAGCGAGAATCGGTGCACT
AACGACGAGCCTTGTGATAATGAGTTGTGCGGCAATTGGCATCACGCGGAAGCACACACGGACAACTGCCGCAATCCCCAATGTGAATTCAAGCTTCGTA
TCATTTTGCGAGAAGTAATGCACGGTATCGAACACAATCAGCGAATTGTTCAGGAAGAACGCGCAAAGGTGCAAAAGAAGACACTGGCATTAGAAGCTAT
TCAGCGAGACGAAGAGAGCGCGAAGCACCATGCTGAAAGTTTTAATCTGCTAGACACTCGGCAGCAGGACCGCTTTTACGAGTCTAAAGTGCTCCAGGAC
GAGCTTGACCAACTCAAGGGGGACCTAGCGAAGGAAGAGCAACTACTACAAAACTTGTACGACAAAAGAACGGAGCTGAAGGAGAAGTTGTACACCATCG
GAATCGACGAGAGCGATGACGTGATTGACGGGTTTCCAGAGTTCACCAGTCACTATGAGAACAAGCGGGGATCAAGAAAGCAGAGGGCACATTAAGTGCC
AGCCAGCAATTTGCGACAGCGTACCTGCAGACCTGCCCGTTGAATATGGATTGGAGCACAAGGGCAGATTTTCGACAAATGCATGTGTTGTTCCTCAAAT
ACATTGAAGTACTTAAGTATCTCGGCAAGAGAAGTCTGCAGTCTGGAGCGGCAACTTTATCGGAGGAGCTGAGTGCCCCTCGGTCAGCGACAAATCGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGGTCCAATGAGCCAAACCGTAGATCCAGTGCCACGCCGAAAAATTCTTG
GCACCGTTGCTTCCATACGGAAAACAGCTTCGTATACGCAAAGGCGGTCTCCGTCCTGACGAACATAAATGCCATCGGGTAAATCTTCTGTTGATACGCA
TGCGAAGCGGTGTAACGAAGTCCGAATGTGCCAAAAGACACAAGCGGCCAACCACCGAAGTGAAGCTTGTATGTTCCATCTGTGACCCCGAACATCTCGC
CATTTTGACTTGCCACTGTTCTGGGAGCTGTTCGAAAAAGCCTTCGCGAAGTGAAGATGATTCCGACCGAGGTGTCACCACTGTCGATTGTGTCGGTGAA
GCAGTCCAGCACTATGAGCTCATTTTGAAACTCAAAGGGTTGGCGAGCGATGCGCCGAGCGTCCCGCTCGCGATTGTAGCGCATATGACCGAAAAATGCT
GCTGGGGTTGTGCAGAGTCTTGGCGTCGCCCAAACCATGACATCAGCGTAGGTGGTAATGTCCAAATCCCCCCGTCTTCGCAGTAGTTGTGCTCTGTTTT
TGACTTGGGAAGCTGATGGCAGCAAGGCGAGAACTTCTTCGGAGTGATCGTACTTCATGCGTAGGGTGTTCAAACACTTTTTGGGACCTTGGCCTCCCAG
CAGCAAACCGTCGATCTCCGGAAGTAATGGCTTGTAAATCCCCGTCCGCTGCGTCTCAATCGGTGCCACAACTGCCGTATGTATACCACTACGCGACAAC
GGAAACTTGCCGCCGGGATCCAGAGTGATGCTTCACACCTAGGTGCAAAATATGTGATAGCGGCTTCTGTACTTAAATCACCTAGATAAAATAGATATGA
TAGCGACTTCTATACTTAAACCTGCCACGAACCTTGTCCGAACCTTTAAAAAAAAGGCCAGAAATGCTGTAAATGACGCTATGTTAAAGTTCCAGAAACT
TGCTTCGATCCTGCCCTTCTAATTGTTTCGGTACGGCACCGAACAGTAACCCTACAAGCCCTGAACCGAAAAATTTATGCAATGCATGTAACAGCCATTT
CGAATGTACAGAATGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTCCCCGAATTTCAACCCAGGTAAGTTTTTCAAAAGGCGCGCAAATTGGGGGTTTTCGGACCCCCCCCCCCCCCC
GCGCTTCGAGCTCTTTCGCTCATTTCTCGATTCTCAGGTAAAGCCAGACTGATGAAGTGTGCTAATATAGACTGACATTGGGGGAATCTAGAGGAGACTT
CGCCGTGCAGTGTGTGTGGTCGGCCCGTGCATCACTTGTGCAGCAATGAACTCTGCACCAAGCCCGACGTCGACCTCGCGAAAAGGTAGCGCTACCATTA
GTGGTCTTTGCACATAACTTTTGCTTACTGATGCTCTACATGCAGGTTCTGCAGCCACGCTTGCGTGAGCAGGTTCTTCAATACGGACAGCGACTCCCAG
GAGTTCACGCCAAGCAGCCAATCCGGCATATCGTGTTCCAGCAACGCCACTGTGATCGACCTCGCCCAACATGACGCCGAAGAAAAAGAAGAGCCCGTTA
ACAGTATCCCCGATCATGTCGTCTACAAGCCGCCAGCAAACTCGACCGACCCGGTGTGGGAGCTGATCCACCGCTTGGATACACCTTCCATCTACGAGGC
CAAGACGTACACGCATATTTGTCTGCTTTGCGTGCAGACGAAGACGTGGCAGGACTCACTCTGCCGCGCTGGCAACGCATCGAACGCTAAGACCCATCTA
GTGTCCATTCATAAGGACCATGAGTTGGCTATCCAAGAGCAGCGGCGCCGGCTAACCCGTGCAGACCGCTACATGGTGCAGGTGGGGCCCAAAAATGAAA
CCAAGCGGGAAGTTTCTCCAAAAGCAAGATCACAAGCAGATCACCCCCTAAAGCGCCAGAAAACGTTGTGGTCAACTTCGGGGAGCAGATAACGGGCCAT
ATAGCACGGTGGCTGATTCATGATGGTGCGTTTTTAAAAACTTTTATGACTTTGAAAGCTGCTAAATCTCATTATTGCTATGTGTATCTGTGCCTAGGGC
ATGCGCACAACATGGTGACGACTGCTGCTTTTCATGAAATGCTCG