Description :
From Genome Similarity Track
Location :
Scaffold_3:71114- 74068
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.14Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.33Transcription initiation factor IIB
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.34Dolichol-phosphate mannosyltransferase subunit 3

Sequence
2954 bases(100 bases per row)
CGGCCCATGTCGACCGAGCGCCTCGTCGAGTCCGACCGGCGCGTGCTCGTGCTGGCGCGGCTCGAAGCCACGGGAGCCAAGACCGTCAGCTGCTACGCAT
CCGGCTACGACGCGGCCTTCCCGCCAGCGCTAGATGGGATCGGTAAGCTAGCTGCGCCAATCCCAATTGCCATGTCACGATTGCATAGTTTGTCCCATCG
CTGCTGCTGCTGCTGTGTGCCGTCCAGTGTCGAGGAAGGAGTTCAAGTTCTGCATTGAGGTCATCAACCAGACCATGGAGGACTACTTTCCGTGCCTGCC
GTGCTACGCGTGCGGCTTCCTCTGCTGTATCTCGACCTGCGGTCTCTCGTTGCTCTTCCCCGAGCCGTGCACCAGAGAGGTGAGTCTGTTGCTTGACTTG
ACATGGAAGCTCCGTGCCAACGGTGCGTGCACGGACAGCTGGCCGAGAACCTCGAGATCGTGCTGCGCCGACTCAACAACCGCGAGGAACTGCTGTATCG
CGGCATCATCTGGAGCATGCACCGATGTCAGCGCACGCGGACGTCATGGATCGAGATCTCCCAGCTAATCTACGAATGAGCCGCGAGCTAGTGGCGCCAA
CACCAACGTTCATTGAAAACCACCCTTTTTGTCTCTCGGCACCGAGCGTCATTGCCATAATAATCATAATAAGCGCGTATAGTGTACAGGAACGCATCTA
TCGATGGGAGTGGGTGGCCGCATGGGAGACCCGCACAGCGGGATCCCGTCGTGCAATCACGTCCCCCCGTCTTCTTCTATCTTCTATCACTGCCTGCCCT
CTCAGCCTGTCGATGCCAACAACACAAACAGCGCCAGGTCCACCAGTTAGTCAATCACAGAAGCTCCACCATCACCACCAGCGCGCGGCTCAATGCAGCC
TTGATTCTCAACTTACCATGCAGATAGGAGGAGCATTCTTCCTATAAATATGTACGAACCTGAAGTGTGTAATCTCCCTTTCTTGAGCGGTTCGGAGGTC
TTCGTCTCTCATCCCTCCGCGCCATCCATCCATCCCTCATCTCCGCGCCGATCCATCCAGCTTCGCCGCTCAAGTCATCGTGAGCACGCCTTCGAACAGC
ACCACACGACTCTTGTTCAGCTCCTTGCACACGACCTTCATGTTCTTCTCGCCGATCATTGTCACGTCGCTGATCTCCTGAATCGACCGCTTCGTGTCCG
TGTAGGCCGCCACCAGGTAGATCACCGAGGCCGCGACCGCCACGGGAGATTTCCCCGTCGACAGTCCGAGCGTGTCCGCCTTCTTCGCCACATCGTGAGC
GATCGTCTGAGTCTTGTTCGGCAGACCGAGTCGAGAGCAGAACCGGCGAACGTACTCCTCAGTCGACGGCTGGTTCACATCAATGTCGAGGCGGCGCGAC
AGCGTCATGAACGACTTGCCGATCCGTCGCTTAGGCACGCCAGACACGTCTTCCAGCTCCTTCAGCGAGCGCGGATGCCCCGCCTTTCGACACGCCACAA
ACAGCACCGCGACCGGCATGCTCTCTCGCTCAGGTCCGCGCATGTTCACACCCTTCTTCTCCGCATCCGCGTAGACATCCAGCGCGATCTCGACAATCTT
CTTGGGCAGAGACAAGTGGTCCGCGACTTCCTGGATGCGCTCCATGTTGCGCTGCATCCGTTTCACCTTGGTCGAGTCGGACGAAATGCCCGGACGCTTA
TGTGACCGGGGACCGCCGTCGCCGCCGATGGCCGCAGCGTCCACGCCCGTCTTGGGCTTGCGCACATCCACTAGGTAGGTCGAGAGCGAGACGTCGTCCA
GACGCCGGTCCATCGCGTCTCCGACCCTGGATTTCGCAGCGGGGTCGCCGCCCCGGTCATCATTAGCAAAGTTCCGCCATTCGGGGGTATCATCGATAAT
TCTCTCACCGAGGATCATCCCGCAGCCGCGGCACACGACATCGCCGGCGCCGTAGTCCGTCACGACGTCCTGGCTGCCGCAGTCGCCGCAGCGCGGACTG
AAACCCTCGCCGGCCATCACAAGCTCACACCCAACACGCAGGCGGAGAGTACCTGATACCCCCTTTTCGTCTCTTGGCGAGCACCGGCAGATCGAGTCCA
ACCCACGATCAACCCGCGGTCTTGGTCGCGTGGTGTGTGCGCGCAGATATCGGCGCTAAACACCCGGAGAAGCGCGAAGACCACAGGGGAGACGGCGGCG
AACGAGAGCAGACAACCGGAGCCAGCAACAGACGCGCGGTGTCGGCGTAGACAGCGTCAGTGGTGCGTGGACTTGGCGGCGGCGGCGCTTAATGCAGACC
GGTGCTTTGCGCGGCAACCAACCCGCCCGCTCAACCGCCGCCATGGCTCGGATCCACCGACCTGTAAAACCCCAAAACCTCGTCAACCCAAGGTTTTATC
CGAATAGGTTGACATCTGTCGGAGTGATTGTCGCTCTCGATGAAGTTGCCGCCTGTAGATCAACGCGAATAGGGATGAATATGGATGAATATGCACTACG
CTAACACTCACTCAGTCATGTATTACTATGGGGAAACTTGGACCGCCGCGCAATGGCCAGTGAGACCCGACACTGCCCTCTATCACCGCATTCTCTCCTC
GCCTCCGCATTACCGTCTGCATGCTACCACGTTCAACCGACGCGACGTCACTGGAAATTGAAGCCGCGGCGCTTGAGGTCGGCCTTCGCCTCGATCACTT
GTCGGTCGAGCTCCTTGGACGCTTCGGGGAAGTCTTGCACGGCCATGACGTTCAGCGCGATGACCGCGAGCGAGTAGGCGCCGAACGTGACGAGCGCGAG
CATCGGCAGCACGTTCACGACCTGCAGCACGCGCGCGTCGTCCACGGCCGTGGCCACGTACTGGCGCAGCGTCCACCAGAGCGCGAAGAAGGCGACCAGC
GCCACGAGCCACTTCTGGTACTTGAGCATCGTGCTGTTGCTTTCTGTCTTGTTG