Description :
From Genome Similarity Track
Location :
contig_93:71114- 73095
Transcript NameFunction/comments
g13213.t1hypothetical protein

Sequence
1981 bases(100 bases per row)
GGCGCCGAGGATATGTGCGCGCTGGGCCACCTACACGAACCCGCGATCGTGTACAACGTGCGCGAGCGCTTCTACGCCCAGGAGCCGTACACGTACACGG
GCAAGATCGTGGTGGCTGTGAACCCGTACCAGTGGCTCAAGAAACTCTACTCGGAGGAGCTGCGCGACCAGTACACGCAGACGCCGTGGGACGAGATGCC
GCCCCACGTGTACGCAACGAGCGCCGAGGCCTTCCACCACATGAAGCAGCACCGCATGCCGCAGAGCATCTTGGTGAGCGGCGAGTCCGGCGCGGGCAAG
ACCGAGACGGTCAAGATTATGATGGAGCATCTGGCCAGCATCTCCATGGGCATGGCCAAGCGCCTGCACCCCACGGAGAGCGGAGAGACGATTGTGGTGG
AGAAGGTGCTCAAGAGCAACCCGCTGCTGGAAGCCTTCGGAAACGCCAAGACCATCCGCAACGACAACTCGAGTCGCTTCGGAAAATTCACGCAGCTGCA
GTTCAATAACGAGCTCTGTCTTGTAGGTGCCGAGTGTCGCACTATTTGCTCGAGAAGTCGCGCGTGGTGGCGCAGGCAGCGGGCGAACGCAACTACCACA
TCTTCTACCAACTTGTGAGCGCCAAGGAGGATATCTTTGGCTTCAGTGATGACTCGTCCGCGAGCGAGTTCAGGTACCTGCAGGACGAGAAACTCATTCT
GGACGGCCAGACGGACCTTGAACGGTACCAGGTCACTCGTGATGCGCTGAGTACCATTGGGCTCAGCGACGAGGAGCAGAACCAGCTCTTCAGTGCTCTC
TGCGGTATCTTGCGTCTGGGCCAGCTCGACTTTGTTCCTTTGGAGTCAAACAAGGACGATGCCAGCCAGGCGGTTGCTTCGTTGAATGCGTCAGCGACTT
CTGCCCCTGTCACTGCGGAGCAGATTGAACAGCAGAAGATGGAAATCGAGCAGTGCGCGAAGCTGCTGGGTGTGGAAGTGACCGCGTTGAGCAAGCAGCT
CTGCAGCCGTACCGTCAAGGCGCGCCAGGAGGTGTACTGCGTCCCGCTGTCAGCTCTGCATGCCGGCAACAATCGTGACGCTTTAGCGAAGGAGATCTAT
GCGCGAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGC
TGGATATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGT
GTTTAAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCG
ATGGGCGTGATGGCACTGCTGAACGAAGAATGTGTGCGCCCCATGGGAAGTGATTTGTCATTTGTATCGAAGCTTGTGTCACTGCGCGAGTCACATCCAC
GTCTTGAGCGAGCACGCCTCAGTCAGACGCACTTCATGCTGCACCACTATGCGGGCCCCGTGACATACGACGCGGAAGGCTTTGTCGAGAAGAACAAGGA
CTCGTTGCAGACTGATCTACTGGAGCTGCTTGGTACGAGCTCAAATGGCTTGCTGTCGATGGTATTCGGCGACGACAACAACACAGCATTCATGACAGAC
GCGGATCTGGCTGTCCGTGCGGCAACCATGATGGAGTCGGGACGACGCAGTACTGTCGGACGGAAAACGTCAACCTTCATGCAAGAGACCGTGAGCTACA
AATTCAAAGCACAGTTGTCGCTGTTGATGAGTGACATTTCCAGCACTGAGGTGCACTATGTACGTTGCATTAAACCCAACTCGCAAAAGAGCCCGAGTGT
CTACGAGATCGATGCGGTTGTGAACCAGCTTCGCTGCGCCGGTGTCGTTGAGGCCATCCGTATCACACGCGCCGCATTCCC