Description :
From Genome Similarity Track
Location :
Scaffold_686:711- 2561
Transcript NameFunction/comments
g12460.t1hypothetical protein

Sequence
1850 bases(100 bases per row)
GAAGGAACACTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAAGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTTATCTCGTGCCGGGAACGAAGTATTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCACAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACC
ACAGGGCGGGTGGCGCATTGTTCATGCGTGTAACAAGCTGAACGATGCGACGGTACCGGTACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCATAGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCACAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCATCACGCACTTGTTGCGCTCGGTGCG
CGACTTCGCACCGAGCTATTTCGATGATGTGTTCGTTCACAGCCGGGCTGTGAATGGGAGGTCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTG
CTTGAGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTTGTCTCGTGGGGAAGAAC
GGCGTACGACCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACT
TGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGC
CTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCACCGAGCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCG
ATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGGTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTAC
ATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCTAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTTCTACACCGACCACGCATCGT
TGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGATTACAACTCCCAGGTTGAGTACAAACCTGGAAG
GTTAAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCCTTGCTGGATGTCGTGAA
GGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCC
CGTGTACACCGTTATCGTGTACACAATGGTCTGCTGTTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGC
TCAAGATCACGTATGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCGCGCGTGACTTCTACTGGAGTCACCA
GTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTG