Description :
From Genome Similarity Track
Location :
scaffold_35:71097- 72262
Transcript NameFunction/comments
Pl_111560hypothetical protein PHYSODRAFT_347790

Sequence
1165 bases(100 bases per row)
TGGACCAGAGTCTCCTCATCACGGGCGAGTCTGGAAGTGGCAAGACAGAGACGTCCAAGCACGTCATGCGGTATCTTACTACCATCAGTACGCGCTCTAG
AGCCAAGAGCGCTGTCATTGCGAACCGCCGCATGTCCGTCGCACAACGCAAAGAAGCTGACGAGATGACGAGCCACGTCACTGACGTGCTGTGGGGCAGC
AACCCCGTGCTCGAGGCCTTCGGTAACGCTCAGACCATCCGTAATAACAACAGTAGTCGCTTCGGCAAGTACATTGTCTTGCAGATGAACCGCGTGGGTC
AAGTCATTGGAGGATACATCGACAACTACCTGCTGGAACGCAGTCGTGTGATCCGTCAGGCGGAGGGAGAACGCAACTTTCACTCCTTCTACCAGCTCAT
GTCTGGTGCTTCGGCTGCGGACCGTGAAGCGTGGCAATTGCCGGAAAGCGCGGACGAGTTTGACGTTCTCGCCAATGAAGACGCGAAGATCGAAGGTGTA
GATGATGCTGAAAACTACCGCAATGTGCGTCAGAACATGACGGCAATTGGTATCACAGACGAGGAGCAGCGTGATATTTTCCAGCAGCTTTCGGCTATTC
TATGGCTTGGTAACGTGCAGTTTAAGCAGACTACGGATGAAGCACATAACCCGCGTGGTGCTATTGAAGACCCCGCAGCACGTGAGGCTCTGGTCAAGGC
TGCTAGTCTGATGGGTATTGACAAGGACAAGCTGGAGGCTCTGCTAACGTTCCGTATCGTTAACATCTATCGTGAGGACCAGAAAGTACTGTACGACGCC
CGCCAGGCAAAGAAGGTGTGCGATTCGATCATGCGCTCGTTGTACGAGAAGATTTTCGACTGGATCGTGGCACGTATCAACAAGAATGTGACGTGCAGAA
AGCGTGACATCAGCAATAGCATCGGCATTTTGGATATTTACGGGTTTGAAATCTTCGAGGTGAATGCGTTCGAACAGCTTTGCATTAACTACGTGAACGA
GAAGCTACAACAGTTGTTCATTAGCCAGACACTCGAGAGTGAGCAGGAAGGCTACCGCCGCGAGGGGCTGAGCTGGCAGAATATTACGTTCTTCAACAAC
CAAGTTGTGTGTGACCTGATTGAAGACCCTAAGCAGCACGGTATTTTCCCGCTACTGGATGAGCA