Description :
From Genome Similarity Track
Location :
contig_6:710905- 712298
Transcript NameFunction/comments
g2202.t1XP_009515075.1 hypothetical protein PHYSODRAFT_472847 [Phytophthora sojae

Sequence
1393 bases(100 bases per row)
GGCCGCCGCGCTCCAGATCAAGCCCAACCGAATCCTCTACACGAGCGTCCTTCTCTCCTTGCTGCAGCCATTCCAGAGCGGGTGGTCCACCTCGCAGCTC
AACCTGACCGACTACAACAACACGGACGAGTGCAATGCTCGCCCGGTTGTTCCCGGTACTTGCACGCTGTTCAGCGGCCACTCCAAGCTCGAATGGACTT
TCGCCGTGAACGCATGGATTTTCGGCGCCATGGTCGGCAGTTTGCTGTGCGGCTACTTTAGCGACATGCTTGGTCGCAAGAAGCTGCTCTTCTTCAACTG
CTTCTTCATGATCGGTGGCGCTGTCATCCAGGCATCCGTGTCCAATGTGTGGCCATTTGCCTTTGGCCGTGTAGTCTCCGGCATCGCCTCGGGTGCTGCC
ACGGGAACCATCGGTGCGTACGTCAACGAGCTGTCGCCACCGCACCTGCGTAGTCACCTGGGTCTTGGCCTGCAGATCTCCACCACCATCGGCATCCTGG
TGCCGGCTATCTGCTTCTTCTTCGCTGACAGCGGTGATGGATGGCGCTACCTGGCTGGTTTCCCCATTGTGTTGGCCGCCATCTACATGGTGCTATCACC
TTCGCTGTCTGTCGAGAGTCCCGCGTGGCTGCTCATGAAGAACCGCCGCGAGGAAGCCAGGCAGGTCATCACCCGCCTGTACGGTGAAGAACACGTGGAA
ACGGCGCTGGGCTGGCTTGAGCCTAAAAAGCAGCTCGGCGAGGCCGAAGAGGGCTACTCCGTTGTGCCAACCGAGTCCGTGCTGTCGCCCAAGTACCGTA
CGCAGTTCCTTGCCGGCCTTCTGCTGTCCTGCACGCAGCAGCTCTCGGGTATTAACGCTGTGTTCTACTACTCGGGCAACATCTTCTCGGACGCTGGTAT
CGATGACTCGCGCATCGGAACGCTCATCATTGATTTCATCAACATTTGGCCGGCCTTCTTCACGGGCGTAATGGCCACGCGCTTCGGCAACCGCAACATG
ATCCTATGGGGCATTGCGGGCATGATTGTCATGTCCATCGGTATGACTGTCGCCTTCCTCGTGGACGTTTCAGCTCTCTCCATCGTCTTCACGGCGCTCT
ACGTGATTGTCTTCGGTGTGACCTTGGGTCCGCTCGTGTGGGTCATGACGGCTGACATCTTCCCGGACTCGATCCGTGCCAGCGCTTCGTCCATTTGCAT
CGGTGCCAACTGGCTCTGCAACCTCATCGTCGGCGTGGGTTACCCGTACCTGGCGGATGCCTTTGACGACTGGAGCTACACGCCCTTCACCGGCTTGCTC
ATCATCTTTTTCGTGCTGTCGCTGAAGTTGGTGCCGGAGACATCGGGTAAGACGAGCGAGGAGATCCAGGCCGAGTACGAGGAGCGCCGCCGC