Description :
From Genome Similarity Track
Location :
Scaffold_55:7109- 9701
Transcript NameFunction/comments
Albla_Nc14048250
Albla_Nc14048260coiledcoil domaincontaining protein 94 putative
Albla_Nc14048270
Albla_Nc14048280

Sequence
2592 bases(100 bases per row)
CTCCCATCGGAAGCTTTTGCGATCAATTTCGACATGTGAGGACATAGTTTTGCTAATTGGGCAATGTTGGGTAGGAGGGCTGCACGCGCGGTGGGGAGCG
CATGCATAAAAGGACATCGAGTGGTTGCTTGCATTCGAGTCGCAGACACCGACGCTTTACGAAGTGCCATGACTTAGGTGAATTAGTTGACAAATTCGAA
AATGGTTCAATTAAAAAGCGCGTTTGGAAGCGGGTAGGGTATAATGTGACTTGTATTATACTTTAGTATAAACAAGGCTTGGATTGTGCTGGACTCAGCT
TTCTACCCTCAGCTCTTTATAAAGTGTGAGGAATACGATTTGGGAACTGATCTTGGAACCTTACATTGTGGTTCGTTTCAAAGTCCGTTTCCGTACCATC
AACGCATCAAAGCGAACTTTGGAAACATGGGCGAACGCAAGGTGCTGAATAAGTATTTTCCGCCGGATTTCGATCCGTCTTTGGTCCCGCGACGACAGGG
ACCAAAGAACAAACAGATGGAAGTGCGTATGATGCTTCCATTCTCTATACAATGTGACACGTGCGGAGAATATATGTATCGCGGAAAGAAATTCAATTCG
AGAAAGGAAGAGGTTGTGGAAGAAAACTACCTTGGACTTCGCATATACCGCTTCTACATCAAATGTGTGACGTGTTCGTCTGAAATCACATTCAAAACGG
ATCCCAAAGCGGGCGATTACGCTGCAGAGCACGGATGTAGTCGAAACTTTGAGCCATGGCGAGAGACACAATCTTTACAAGAAACCGCACTTAAGAAGCA
GCAAGATGAAGAGCAAGGTGACTCCATGAAAGCTTTGGAGAATCGGACAGTAACTTCCAAACACGAAATGGATCTGTTGGATGCATTGGATGAGATGAAA
GCGATCAATCAGCGACATGCGCGTATCGACACAAACGCACTTTTGGTGCAACTTGCTCATGGGCCTAGTGAAGAGTGCGCTGAGAAGGAGGATCAAGAAC
TTGCAAAACTTATATTCTCACAGAAGAAAGAGTCGAGCTCTGAAGAAAGTAGCGTTACGGATCGCGATATCAAACGTTACCCGTTATGGCAATCTAACAC
GTTAACACCGACAGCCAACGCGATAACACCGAAATCTGCTCCGGTTCATGTGAAGCGAAAGCTTTGTAGCGTTTCTGTACCGAACAATAGCACGCGATCG
ATTGAGGCCAAGAAAGTGAAAGTCGTCAAGGCAGAGAGCAGTAAAGCTTCTCTTGTCGCGGATTATACCGATAGCAGTGATGACAAAGCATCCGATTAGA
ACGAATCCCATTCGGATTTAATGAATAAAACAAGGTACATGCATGTTTAGACCGGTTACGGACCGGTTTGAAACACTTGCGAAGGAATCAAAATGATTTG
CGTTTGGCTCCGCACTGCTTTACGTAAAGCCGCTTACAGCTCGAATGTACAATATGGCGGGATCACAACGCGGTACAATCGCTCTCTGTACATCAATCTT
CGCGATAACCGTGAACTGGTACGAGCTAATGGACGTTTACAGCGATATATAACAGACGACAAGTTAATGAGTGAAAATCACGTGATAATGCACGAAAAAA
AATGGCAAAGACGTCGTCGAAAAGCGGGAGAACAACTCATTCGTCATGCAAACGCTCGACTCGGAAAAGCAATCAGTTTTTTTATCGAAAGAAGAAACGG
AATTATCGAATAATCAATTCGGTCTTTGAGGTCATTTTAGTGTGTTTTTACTCTAAACGAGGTAACTCCTAGCTCAAGTTAGTGTGTTCTACTCTAAATG
AGGCGTCTACTGCTTGGAATCGTTGAGCCATTGACGAACTCTTGCGATTTGTACTTCCACAGCAGCCTTACTGGTGCCTCCATACACATTCTTTCGCTCC
ACACTGACCTCATAATTCCATATTTCCATCACATCGCTCTCAAATTTCGAATGGAGGGACCTCAGCTCCTCAAACGACAACTCACTCAGCGACTTATTTT
GGTCTTCTGCTAAGCGAACTGCTGCTCCAGCGATATGATGTGTCTCGCGAAAAGGAACGCCCTTACGAACCAAATATTCTGCCAAATCTGTTGCAAGCAT
CTCCGGTACCAAAAATGACTCCATCCTGGCACCATGAGGCGTCATGGTCGCCAGAACGCCGGTAGCAATTTGAACACAATCTAGCATTGTGTCCACCACA
TCAAAAAGGGCTGATTTATCTTCCTGCAAATCCTTATTATAGGATCTCGGAAGACCTTTCAATGTGACCATAAACCCATTCATGCGACCCATAACAGTTC
CACATTTGCCTCGCAACAGCTCCAATGCGTCCGGATTCTTCTTCTGCGGCATCAGGCTACTACCGGTGCTGTACGCGTCCGCCATACTCACAAATTTCTA
CACACCAATCATCAGCGCCTATATCGAAACAAGGATATTGGGTCCATACCAAAGTGTTGTAAATGATCAAATCCTCCGACAATTGAGAGAAATGAACCAT
TGTCAAGGAAGCCCAAAACAGAAACTCTGCAATAAAGTCGCGATCACATACTGCATCCAAACTGTTGCATGTGACATTCCGAAATCCTAATT