Description :
From Genome Similarity Track
Location :
scaffold_73:71087- 72481
Sequence
1394 bases(100 bases per row)
AGTCACCGAAATGGTGCATTGGTATCGGAGAAGAAGCTGAGCTCGCCGTCCGTCATGGATGAATATGGAGCTTAAAACACTTGCAGTGCATCAAGTGCGA
GGGGCGATGCTTCCATTGCAAGGGGTCCGGCAGGCCCTTGCTATCCTTTGTTGAAGAAATATCACAGTGTGATTCCCCCGATCAGACAGCGCGTAATGAA
ATTGACTTAGTCTCCGGAATCAACTATTGCATCACACGACCACGGCGTTTACCAAGGGACCcgtgtgatgtcattgacgatTTCATCCTTGCAAATGACA
ACGCTGTTGGTGTGAGAAAGCAAACTTCTACAATCGCTGTTGCCGTTCTGGGTCAGAAAAATTATCGTCAAGTGGCAAATTTCTGCGATAATGATGCAAA
CGCCAATTTTTACAAAGGATGAGCTGCAAAATCGCATGGTCGTCTGCACTCTGctgatctttttgatgatTTGAGCAGACTGCTGATCAGAAAAAGCAAC
TTCTATCTCACTGCAGCGAGGAGTCCAAGCGAGATGTTCAGGTAGTGGCTAATTATGTCGTAGAGCCTGTCCAATGCATTGATGGCTGTCAATCGTCTGG
AGACACATCAAATCGTAGCTATGCACATATCGTAGCTATGCACAAATCTCTTTTGACGACATATTCGTTCATAGTAATTAGCATGGGAAGTTGAATGTGG
AAGACAAAATCAAGCAATTCCGggtggtgctcgagtgtacgCGCCTAATTCAGCAAGACAGACTTGCTCGACATTATTTACAAATCTGTCTTGTTTGACG
ATATATACAACTCTGCCTTTGGTGCCGACAAATCCTTTTTGATTGCTTCACTTGATTACGGATCTGCTGGCAGATCCCGCAAAGATAATGGCCGTTGTAA
TTTGGTCAGTGCCTCTGACTTTCGATGTGTATGCCTACATGGCACGACCCCACACCAATCGGCTTAAATGGTAAGGATGTGCTGGAAAGGATGGAAAAGA
AGACCTTAGATGCTGAAAGTAAAGCATTAAGGGAGCCCCGACTCAGCTCTTTTGAATGCAGAACGATTATTCTCGTCGTCTCAATGCATTTAAACGCATG
TTTATGTTTGAATTTTTGCCAGCTGTAAGCTGCTGAGTAGAACTACTCCAGTCTTGGATGTAGAATAGGGTACCAGTGCAAAACTGTCAGACATAGACAG
GGTATCACCGAAAAAAATACCATGATCTCCTGCGCCCAAAGCAAGAATACTACGTGACAGGAAGCTACTTTCAATAGAGTATGGcctcgtcaagctcaga
atGCACCTGCTGGGCTCTTAATTGTTTTTGATCTATACAGGCCATGCGTCGTTGCGTTCAGCGACGTTATCATCACATCTCTTTCGATAATGGC