Description :
From Genome Similarity Track
Location :
scaffold_73:71072- 72481
Sequence
1409 bases(100 bases per row)
ATTGCATGAAGGTGAAGTCACCGAAATGGTGCATTGGTATCGGAGAAGAAGCTGAGCTCGCCGTCCGTCATGGATGAATATGGAGCTTAAAACACTTGCA
GTGCATCAAGTGCGAGGGGCGATGCTTCCATTGCAAGGGGTCCGGCAGGCCCTTGCTATCCTTTGTTGAAGAAATATCACAGTGTGATTCCCCCGATCAG
ACAGCGCGTAATGAAATTGACTTAGTCTCCGGAATCAACTATTGCATCACACGACCACGGCGTTTACCAAGGGACCcgtgtgatgtcattgacgatTTCA
TCCTTGCAAATGACAACGCTGTTGGTGTGAGAAAGCAAACTTCTACAATCGCTGTTGCCGTTCTGGGTCAGAAAAATTATCGTCAAGTGGCAAATTTCTG
CGATAATGATGCAAACGCCAATTTTTACAAAGGATGAGCTGCAAAATCGCATGGTCGTCTGCACTCTGctgatctttttgatgatTTGAGCAGACTGCTG
ATCAGAAAAAGCAACTTCTATCTCACTGCAGCGAGGAGTCCAAGCGAGATGTTCAGGTAGTGGCTAATTATGTCGTAGAGCCTGTCCAATGCATTGATGG
CTGTCAATCGTCTGGAGACACATCAAATCGTAGCTATGCACATATCGTAGCTATGCACAAATCTCTTTTGACGACATATTCGTTCATAGTAATTAGCATG
GGAAGTTGAATGTGGAAGACAAAATCAAGCAATTCCGggtggtgctcgagtgtacgCGCCTAATTCAGCAAGACAGACTTGCTCGACATTATTTACAAAT
CTGTCTTGTTTGACGATATATACAACTCTGCCTTTGGTGCCGACAAATCCTTTTTGATTGCTTCACTTGATTACGGATCTGCTGGCAGATCCCGCAAAGA
TAATGGCCGTTGTAATTTGGTCAGTGCCTCTGACTTTCGATGTGTATGCCTACATGGCACGACCCCACACCAATCGGCTTAAATGGTAAGGATGTGCTGG
AAAGGATGGAAAAGAAGACCTTAGATGCTGAAAGTAAAGCATTAAGGGAGCCCCGACTCAGCTCTTTTGAATGCAGAACGATTATTCTCGTCGTCTCAAT
GCATTTAAACGCATGTTTATGTTTGAATTTTTGCCAGCTGTAAGCTGCTGAGTAGAACTACTCCAGTCTTGGATGTAGAATAGGGTACCAGTGCAAAACT
GTCAGACATAGACAGGGTATCACCGAAAAAAATACCATGATCTCCTGCGCCCAAAGCAAGAATACTACGTGACAGGAAGCTACTTTCAATAGAGTATGGc
ctcgtcaagctcagaatGCACCTGCTGGGCTCTTAATTGTTTTTGATCTATACAGGCCATGCGTCGTTGCGTTCAGCGACGTTATCATCACATCTCTTTC
GATAATGGC