Description :
From Genome Similarity Track
Location :
Scaffold_73:7107- 8391
Sequence
1284 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAGCAATCTACTATCAAAATCCAGGGGGGATTGCTAATAACCTCCCGAATCGTAGGTGAATATGAAATGAAAGCAGTCACTCTAAAGCAACCACAGTCA
ACTGACAAATGAAATAGGCGGATCAATCCAGGGATACGAGTTCCTGGTCCCCACCTAAATGGGACTTAGACTTAGGTGAGAGTTTTCGCACGGGTTCCTC
GATCTTCGTGCGGTCTTGGTCGTCCGATACGCCAGCGCTCCCGGGTCGCAGCCTCGTAGTAGTCGCTATAGGTCGCAGCAGTCTTCCTCAACGCAGTACG
CTCAAAGCAAGGGGGCCGACAAGGCACCACTTCTCACTTCCAACGCAAAACAAACTCTGTTTTCTTCTTATCACTATCTTCTTCTTCTGTCTGACTTGGT
CTACTGGATTCTTGGCGGTCTCCTTCGTCGTGTCCGCGCACTCGCATTCAGGTTGACTTGGTCTTAGTATGGTGGGTTGCACGT