Description :
From Genome Similarity Track
Location :
Scaffold_9:71065- 75415
Sequence
4350 bases(100 bases per row)
TTGCATTTGGCGTTTACCACAGTAAACTTCGAAACTGTATCAGACACGGTAAAGAAATCGTTAGCATGTAGCAGACACGTTAAGACAACTTTATAGCCAA
AAAAAAATGCGCTTGAAGGCGCGTCACAAACGTACCGGATGCAATAAGCCGTCTCAGAACAGCACAGCATGAAGAGCTTAGTCCCCCATTTGTGAGGCTT
ATCTTTCATGTACACTCTCATGCGATTGAAAGCCGATCTTAAAGGAAGCATCGCTTCATCAAACGCCATGACCGGTGGCGGTACAAAGCTGCGCTGGAAA
GTATGTTGCAGTACGATGATTACTGGATCCAGCTTCCACGCGCGGTCCGTCGCTGCCTCAGGAGCATCATTGCGACTGAAATGCATGTTGCGGGAAAGAT
GAGCAAACCGATCTCGCTTCATATAATGGCCGAAGCACCCACGCGGAATTGCGCCTTCGTCGGTAGTGGTCAAATTTCTCCTTGTTCGGCGCAATTGTTC
TGGCAATGAGTAGTCCAATAAAAATACAAAAATCTCTTCCAGATATGTCAGGTGTTGTCAATAAATTCTCCTTGATTTGTTCTTGCGATTTGACTTCAAA
ATTGTTGTCCTTCCGGTGGCGGGCTTGTTGCTTTGCACGCTGTGCGCCAACACGCTTATCCAAATTGTGAAGGAAATAGTCGTCACTAGCCCCGGCAATG
TCTTCCCAAAGATGGGGAGGTGCAAACAAGAAGAATGACCCCAACGCGGTCGAAGCAGCGGAAAGGGCTTCTTCAGTAGGCCCGTGATCCCCGCTGTAAA
TATTGGGATAGTCCTCCGTAAGCCATGCATCAGTCCGAGCCTCGTACGGCTCGTCCATGTAGGGAAAAGGCAATTGGGTATCAGGTCCATTCCATCCATT
GAGCTTCATGTCTTTTAGAACATCCTTGTGTACACTACCGCGCGCAAGTGCTCCAACTCCGCCAACTGATTCAAGTAGAGATGGCTCGAAAAGTAAGTCA
GGAGCAGCAGCAGAATCCTCCACGACGGCGTCGGCTTCTTCGAGGCCTAAGTCCTCATCATCATCGTAAATGGACATATTCTCATTGTCACCATCGGAAT
CCAGTGCTGCAAAATCTGCTGGATTATCTCCAGGCTCGATAATGTTTGGGTCATCTACATCCACATACACTATAAGAATCCATAACGTGTATTCTTAACA
TGTATATACACCATAAGCTTACACATCATTGCTCTGATTCCATATGCAACGCTGACGCTTGGTTGCACTTTTTCAGGTGGTATGGCGGCCGGTTGCCCTT
CTTCACCTGGCATCGTGCTTTCTCCGTCGCTATCAGGCTCAGAGCAGGCATACTCTGAGCCAGATGTAGCAGCAGCATCGAATTCAGCATGTAAACTACA
ATTGGGATACTCGTCAGTACCTATAAGGGAGTGGTGTGTTAGCGTTAGCAGTAGCTCACAGGTACAAGCAATGTGTTCGAACTGCTTACCGTTTTCATCA
CCAACTGAATTGCCCAAATCACTCTCTGCCAGGTGTGGAGAGGTAGCCTGAATGTTCGGACAAACAGTCTTTGTCGTGTCTGGATCTGGACTGACAGTTC
GGTCAGCAACTATATACACGATAGCGTTAGAATCATAACATGTACATACACAATAAGATCAAACGCACCATCTTGTCTATCAGGCACATCGGTTTCAGGC
TGTCCACTTTCCGGAGTAGGTTGAGTCGCTGCCGCTTTTGCTTGTTGCTTCGCCGCGGTAGCTTTCTTCATCTCCTCTAGCAAAGCACACGTATTAGAGT
CCACACAAAGACCTTGAAAGGCGATACTACTTACCCAAGGCGATACGGTCCAAATATGCCATCAACGCAGCCTCTCCAACGAAAAAGTCCACGCCACGTA
CGTCCTTCTTCGTCTTCCCCGGCATAAGGTACGTGTAGTCGTTTGACAGGCCCGTAGGGGCCTTTGATTTCCATCCTTCCTTCAGAAGCTCTCGCCATCG
GCCTCTGAACCCGGACATCTGAGCGGCAGCGGCGAAAATTCTCGAATGACCGAGATATGGGTGGCGCAGAATTCCACCTGCAATCCTATATGCTGATTTG
TGTGACACCCATTAAACCTGTGTCTTCTAATTTTCTAGAAAAACCAAGTTCAAGGCACACGCATAGCTATGTACTGCTGTGCGGAAAGATGGGAAATATG
CCTACCCCTTCTTGACTGACAATTTGTATGGTTCTATACAAACGTTAAGTATAAAAGCTTAACGTGTCTCAGACACGTTAAGCTTTTCGCGGAATCGTGT
CTCATACAGGCTCTCGGGTTTGGGGGGTTAAGACTTCCAAAATGTTGCTGTTGAAATTTGATACCAGGACCACCACGAGCCCCTTGACAACTTGAGCAAT
TCCAGCCGACCTATGCAAAATAATTGGTATTAACCCTAACAAGATTTTTTTAAGGACAAAAATGAGGACCAAATTTCAGTGGTGTCCTGCAGATTTATAG
TCAAATGCAAGGAACAAGATAAATGTTTGTCATGTCTTCTTCGTTATCCTTCACGAACTTGACTCAGTAAATATCGAATCGGCTTCACTACGCTACTTGA
AATCTTGCACTCCTAAGACTGATTTCACTGAAGTTTGTCCTAAAGTTTAGAACAAATTGCTGTTTGCTCGGTTTGTCACCTTGACTACTGGCTGCAAGCG
CAATGATCGTCGGCGATGCCTGTTCGTTAAGCGAACGCTTGGTGCTCGTCGATTCTGAGGATCCAATACTCTGGATGGCTTTCTGGATGGAGGCGGTGCT
CTGTTTTCGTTTGACTTGGTTGACTTGAGATGGTGTGACCTCTTGCATGGGTCTGGCAGCTTCCTTTCACGATGAAAAATTTCGAAACAGGACTCGCCAT
CACTCCATCTTGCTGCGCGACAAAGTGAAACATGGCAGATATCACACTCAAAGCTTGTTTTGTACCCTTTACGCGTGTGATTGCCATTTTCACTGTCGTG
ATTCATTTGACAGCAGATAATGCAGCATCTCTGACGTGCACCCTGGATCCGGACCTGTAGTTGAACGGTTTGATTGGATACATTATTATGAGCAGATGAA
GCGACAATTGTCCCGTACCTCATGGTGATCATTACTTTTAGAGAGCCGAAGATGAATCCACTCTGTGGATGACTCGAAGTGATTTCGTTTGTTGCACGCG
AATGAAAGTTCCAATGTCGGTGGACCTGACCGATTCTCCTTGTCTCGAGCATCGCTAAGTGGGCGCAGAGAGCCTGCCTTCTTTGAAAGCACAACGGCAG
CTTCTCGGCAAAATGCGGCAAAACTGGGGAGATTTTGCTTGTGTTTCTGATAGGCCTTGTAGCTTGTACATAGTCCTCGATTCATAAAAAAACCGTGTGA
CTGCAAGAATCACAGTTAGAACCCATATTCTGCGCGCGAATTGTGAGCTGCTAGCTACCTGGAATAACAGAAACGACTGGTAGGCATTGTACACTAGAGT
CATGAGCAGACGAAGCCAAATTGTTGCACTAGGTGTCAGTCGGAAATGCTTGGACTTGACATTCTTCAGATATCTTGAATAGACATCGATCCCCCCCTTG
ACACGATTCCACAACGCAATTAAAGTTGGCATGATATGCTTGGCTGGAGGGAGTGGGTTTTGCCGCTCGTTGATAAGTCTCACTAATGCCCTCCATAACC
CCAGGGTTTGTACCAGCGTGGCTTGATCAACACAGTGTCCTAATTGCTCAGTTTCAAACTCGGGAATGCTGGCGGTTTCTGTGTAAACCCACTCCATGTA
GCCCAACGCAATTGCCTTCAATGCACTCTGGTAAGTGTGAGATGCACTCTCGCTCACGACAACGTGAACAACTCGAATGATGTATGTAGAGGATGCATAC
ACAAGGTATCCATGTGTGATCCCACTGCAAGCAATGCTGTGCAGTATCTGGAGGCGGTGACTGGACTCTGGAATCACTGCGTTCAATCGGAAGCCGGATC
CCATACCAGTCAACTCTACTGTCGTGAATATACCATAAGCTTTAGCAGCAGCTTGTTCCTGCTGAACTGTGCGAGCAGTAGCTCGAGTTTTGTACTCCAT
TACTGCATTGAATCTCCCACATCGCACAGACACGATGGCAGCAATATGATCCGGTAAGAAAGCAGCTACTGGCATATTGCTCCTAGAGAAAAAAAATAGT
TTCTTGTCAGACCCGATTATTATTTTGCTTCACTTACTTGCACAGTAAACCGTATTCTCTGAGCTCCTCGATATGATAGTGTGTGTATTTCCAGAAATAG
CGTGATGTGCGAGGCAATATTGACTTCGTTGGCGGTCCCAATCTTTGTAA