Description :
From Genome Similarity Track
Location :
Scaffold_663:7106- 8188
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_663-snap-gene-0.14DNA excision repair protein ERCC-6

Sequence
1082 bases(100 bases per row)
CTTCGATCGTGCCGCTCGTAATGAGCCGATAAACGGTGACTTGCTTGGTCTGCCCGAGTCGCCACGAACGTTCGCGCGCCTGCAGATCCGTGGACGGGTT
CCAGTCCGGGTCGAAAATCACGACGCGGTCCGCGCCAGTGAGGTTGACGCCAATGCCGCCGGCGCGGGTCGTCAGGAGAAACACGAAAATCTCGCTGCCG
TCTCGATTGAACGCGTCGAGCAGCGACTGGCGCTCCTTGACACTGGTCGTACCGTCCAGTCGACAGTGCTTGTACCCTTTTGCGGCCATGAAGCTCTCTA
GAATGTCCAGCATCTTGCGAGTCTGTGTGAACACTAGCACACGATGACCCTGCTGCTTCCACAGCGCAAGCACCTTGTCGAGCACGCGCATCTTGCCGCT
TCCTTCCGGGTCTCCATACGGTACGCCTGGCGGTCGCTTGGCGAGGTGCCTAATGTCCGTCCCACGCTCTCCGCTCTTGACGTTGTAGTCTCCGACCGTC
GAGAGAAGATCCGGGTGATTACAGATATGCCGCAGAATCGAGATCGCTCGAAACGGGCGCATGTCTTGGCGCAGCACCGCCGCGACCTCGGGCGAGCTCA
GGAAGAGTTCGTAGGTCTCATACTGGCGGGCCGTGAGACTACAGAAGAGAATCTGCTCCATCTTCTCGGGCAGCTTGGTCACGTGTTGGATCTCTTTTTT
CGTGCGGCGAAGCATAAACGGATTGATGACTTCTTTCAAAGCGAGCGCGCACTTGTAGGCCATGACGACTTGCATCTTGGACGCGTTGGCGTACCCACCC
GTGCGAATGGGCAGCACAAACTCATCTTCGAACGTCGGCAGCGTGCCCAGTTTGCCCGGGTACACAAAGTCAAAGAGCGACCAGAGTTCACGGAGCCGAT
TCTGGATGGGTGTGCCCGTGAGAATAATGCGATGGACCGTCTGGAGCTGCTTGCACACAAGCGTGATCTCGGCGTCCGGGTTGCGGATGCGGTGGCCCTC
GTCCAGCACGACATAGTCCCACTCCAGGTCGAGGAAGAGTTCCTGGTACTGGCGGACGTTCTCATACGTCGAGACCACGACG