Description :
From Genome Similarity Track
Location :
Scaffold_5:710599- 723700
Transcript NameFunction/comments
Phyci_1639Hypothetical protein
Phyci_492221Hypothetical protein
Phyci_492479Hypothetical protein
Phyci_209632Hypothetical protein
Phyci_300322hypothetical protein
Phyci_89770hypothetical protein

Sequence
13101 bases(100 bases per row)
AGGTATGGCTGTCTCGTCAAAGCTACGCAATCCTTCGTCTGCAGCGAGCATAACACGCCAAACCTCCGTTGATCAGTGAACACAGCTAAGAAATGACAGC
AGTCTAGAACTTAAGAGCAAGAGTAGCGCCTGCCTTACCAAGAGATCAGCTCGCCTTCTCAGCAAGCTGCTGAGCGTCCCCGCCAGCTTCCGTTGGCGCT
CCACGCCGAGTCTCAGACGGATGTTCTCCCGCTCCGCCTCATCGCGTCGACTTCTCTGTCGCATCGCTAGTTCCTGCCACACGGAGGGGGCACGAGACGC
CAATGTGGTCACGCTGGGAGCATCGCTCCGTCGTCGCAGCGACTCCTTCGCTGGCGTGGCCTCCCGCTCCTGCAAGACCTGGAGGTCAAGTTGAAGCTGC
TCCAGCTGCTCGCGGAGGCGCGAGATCTCGGCCCGCTCTCCATTGCGAACGCGGTTCGGGTCTGCATACACGCCAGCTTTACGCATCGACCTCCGCCTCT
CGTTCACCTGTCTGCGACGTCTCTCTCTGAGCTCGTTCGGGTCTACTATCACTGCAGCTGAAGGGAGCTGCGTACTGGGAGAGGAACCACCCGCGCCTTC
TTCGTCGAGCGCAAACTCGTCCACGAAGGACAGCGCCGCCTTGAAGGCCTCGTCGTCGTCCTCGAGGAAGGCCATGGCACACTTGAACGGGAATACGTAA
CGGGAATGAGAGGGTTTATTGTTGGGGTTGTACCTCTGCTAACGTTAATAATTCGTGTTGCACGAACGCTTTCTTCGGATACCTACACGCTAAAATGACT
TTGTCATCACTGCATACCCTCGGAGGTGGTAAGTCACCTTGATTTGTGCTGATACTGTGCGATGAGTGAAGACAATGACCTCTCGCTGGGCTTCCACATA
TCGTCGAAGCACTTGTATCACTAGAATGACCGCCCAAGAGCTGTTGAAATACAATTACTTGGCAAAGTCCTCAGCAATAGTTGGAGGTGGCTCGAGATCC
GGCAACACAATATTCGGTTTTCAAGCACGACCAGCCAATTCAAATGCTCGCCTTGACCGCCGTCTCGTACAGACCGTCGCCGCCGATATGTTTCTCAACA
CGTCGGAAGTTTTTCCACGTAGCTTCTGTAGTTGCTTGCAGTCCGAACGGGAGATCTTTGTATTAAAAGAACTCGAGGAATTTGCCGTCAGTTCCTTGGC
TGATGTGTGCGTCACTCGGCGTCTTGTCGACCAGGCCGTTCGCGTTGAAATCAACAGCATGATACCGGGCTGACCAAACGTCGAGGTTACATTGGTGATG
AAGCTCTGGAGCGCAGGCCTACAAAAAAACCAAGCTCAGCGCATGTTGTCCTGCATGTAGCGTGCGATGGCTTGGTCTGCTAATGTGTTCTCGATGATTT
CCCTGTGTGCTCGTGTATTCTGCGCTGTGTGGGCGATCAGAAAGTCGGTAAATGCCCGGAGGGTGTGTGCCCCGCAAACAGCCTCAACTTCCGCTtggtc
gaagaagactagtgtgcacaattgtagaatggataactcgcattctgaggttgagctgggtgccggcattgtcactgcgtaaccttgcaagtaatacgtc
agtttacccaggagcttgtgcttgatctctacaggtacagcgcgataaaaccggatgacgacgtcgcgattagactcgacatagcgtcgaatgacctgct
taattcgaatatcggctcgagcagtgttggcgtacagctccttggtgaagtcttcgatgatcgtgtacggttcgtccagatcctTGTCCATTCCAATACA
AACCGCCATCAGATAGATCATCACTCCTTTCACCACCATTGCTCGCCTACCTTTGCCGCTTTCTCATACAGGTTTCCATAGCCGAGGTGCTTTTCGACAC
CTCGAAAATAATCCCAAGTAGCCTCCGTTGTTGCGTGCAGCTCGAAGGGAAGCACATTGTTGCTGAAAAACTCGAGGTAACGGTATTTGTCCTTGGTACT
CTCACGCATGTGGACATCGTCCAGCGAAATACCCATACTTGCAAGACCGTTCCCCTCGAATATGGTGTCCATGTCTTGATAGGCAGCAGCGAGGTGTTGG
AACAGCTCCAGAAACTCGCTACTCCCTGCGCTGAAGTTCAACGCCCGTACGATATGGTGATTCGGATGTGAGAAGTGGCCAATATCCATTATCCACTCGT
ACTCGTTCGCCTGTTTGCAGTGCCACCACGTTATTATAGCGTCAACTCCCCCACAAATCAAACCTCGTGAAGAAAAACGCTTTACCAGTTGGAGAGCTCG
CTTCCGAGCCAAGTTACAGAGATCGTCTGCAAACTTCCGGTGGCGTTCCAGCGAGAGTCTCAGTCGCAAATTGTTGGCTTCTGCTTCCTCACGGCGAAGA
CGTTGTCGCTGCGCCAGCTTCTGCCACATGCTTGGAATCTGGGAGGAAGACGAATTCGTAGCCACAATGACCCCTGAACACTGAGACTGCTGGTGCTGCA
GGACCTGCAGGTCGAGAGTGAGCTTCTCCAATTGTTCTCGAAGGAAAGCGATCTCTCGCGTTTGAGCGTTGCGAGCTCTGTTGGGGTCGCCGTAGACACC
TGCTTTCCGCAGCAGCCTCTTCCTTGCATTTATCTCCGCTCGCTTTCTTGCCTTCTCTTCGGTTATGGGCCATCTTGTTGACGCGCCCTTCCCATCGGTC
TCAGCACTGTGCTCGAACTCATCAATGAACGATAGCGCTGCCTCCGTGACGCGTTCGTCGTCGTCTCCCAGAATTAACGCCATGCCTCGCTGTCCGAGGA
GTTAGAAAATGAGCGGACCTCCAACTCTGCACAGCTGTCTAATCCCTGATGATCGATCACCAGTCCCAGTCCGTCGGTCAAACGCAATAAGAAGATCGCG
TTGACAACCGGGCGTATTCGTAGAGTGCCCGTCTTCGATCGCTGGCTCATGACGTTCACGAATAAAAACAATGCTATGACACAATAGTTAGGATTGTGTC
AGGTCTTTCTCGCTGCCATTCGCTCACCATTCCTAGGGTTCTCTTTTACTAATGCAACTGCGTTCGAGCTTTATCCACCAACGCATTCTCAATCAACTCG
CGATGGACTCGCATATTCTGCGCTGCGTTGACAAGGAGGAAATCGGTGATCGTATCAACGTCTCCAGGTCTGTACTTCGTTTTGACGtcttgatcaagag
cgagcagcgagcactgttggaattcggacagttctcggccaggcgttgagccagaaaagcgctttgtaactgcgtagcctcgcaatcggtaggtcaaccc
acgaagcatcttgtgcttgatctctgctggtctcgctcgagagacccatatgacgatatcgcggtcatcttcgacgtagcgccgcacgacctgcttcacc
tgaatatctgcccgggaactgccggcgtagagttccttcgtgaaatctgcaacgatagtgtacggctcgtcgagatcctGCCACTCGTAAGCTGAGTTAG
AAATGTGTACACTGTGCTGCAGTCCAAGCTCTTACTACCATCGAGACACCCACCTTCTCTGCTTTTCGGTAGACGCTACCATTCCCTAGGTGTTTCTCCA
TACCCTTGAAGTGAGCCCACGCAGCGTCCGTGGTAGAACCCACGTCGAAAGGAAGTACTTTGTAGCTGCATAGCTCGATATGTTTTCCGTCCACGCCATT
GCGTACATGCACGTCAATCGGAGAAATGGTGGAGCTTGCCAAACCGTTGACCGCGAAAACGGTGTCGATTTCTCTGTACGCAGCGTCAAGCTCCCGGAGG
AGCAACTGAAAGTCTGCGACGCCTTCGCTGTAGTCCAGCACGTCAACAACGTAGTGCTGTGAACTAGTCAAATTCATCAGCGACGAGCATTCGTTTCTCT
GAAGAGGACGATAGTATCGTTAGTGAGCTTTCCTGAATCCAATTAGCAGCAACAACGGCACGTACCAGTTGGGTAGACCGCTTTCGCAGCAATCCAAACA
AATGCTTCGCCAGGTCCTGCTGGTGCGCCACTGCAAATTTCAACCGAGCATTGTCTCGCTCGGACTCCTTTCGCCGCCGCCTTTGGTTAAGTGCAATTTC
CTGCCACTTGTTCGGCAAGAGCGCCAGCGAACTCGCGCTCGTTCGGCATGGCGCAGCTCGTTCCTGCGACTTGTGGCCCTGCCACACCTCCAAATCGATC
TGAAGCTTCTCGACTTGCTCACGGAGGTCAGCAACCTCCTTCTTACGAGCGTTGCGCGCGCGATTCGGATCGCTGTACACGCCAGTCTTGCGCAGTAACT
TCCTCCGCGCATTATATTCCGATCGCCGCTTCGATTCATTTTTGCTCGATTGGACCTCGTCAGGCGAGTGGATCTGCATCGTTGCGGCCATGTCGGTATC
CCAAAGAGTAAAAAGAGCGCCATCCCTCGCTTCGTCGAGCAGGAACTCGTCCACCAGAGAGAGGGTTGCCTCGGAGAGCTCGTCGTCACGGGGGGACCTC
ATATTCCCGGTGTACCGCGGTAGTCAAGAAAGGGGTTAGTGTGACAAATCCTACTCGATATCATCAAGTCGATGATGTGGCAAAGACTCCAGCGGAGAAG
TGCACATGGTTTTCATTTACTATTGCAACCGCTGCCGCAGCACTCGATCAGCTAGGTTGTTCTCGATACTCTCACGGTGAGCGACGATGTTCTTCGCTTG
GTGAACGATTAAAAAGTTGACCAACGTGCGAGCGCTTTCCGAGCTGTAAATCGTGCCAGCCtcttgatcgagggacatcctcgagcacaactgcagctgc
gtcagctcttgctccgccgtcgaggccgatgatcgctttgtaatggtgtagccgaggaaattgtaggacaagccgctgagcaatttgtgcttgacctcaa
caggtgtggcatgcgagacccagatcacgatgtctcgatccgcctccacatagcgccgaacaacttgcttcgtttcatagtctgcacgggagctgttgga
gtagatttcaatcgaaaaatcctcgacgatcgtgtaaggttcatcgagattctATCTCGTAGCAAGAGATGTTAGTCAGAGCAACTCCCTCGACCGATAT
TGCCAATTTAGCACCTACCTTCGCTGCTTTTGTGTAGATGTTTCCAACACCCAGGTGCTTTTCCACGCCTTTGAAGTGGTCCCACACAACTTCAGTAGCT
GCCATCACTTCGTAGGGCATATCCTTGTACGTCGAAAACTCGAGATACTTGCCGTCCACGCCTTCGCGCATGTGCACGTCGCCCGGAGAAATCGTCGACC
TTGCCAGTCCGTTAGCTGCGAACACCGCGTCCACATCCCTGTACGCGTCATCGACGCGTTGAAAGAGTTCTCGGAAGTCTTCAATGTCGCCACAAAAGTC
CAGCACGTCGACTGTGTTGCGTCCCGAGCAGCACAAGTTCATCAACGACGCGCATTCGTTCGTCTAGTAGCAGCAGCAGCAGCAAACACCCACACACCAG
TTAATAAATCCTACTACGCTGTCCGCGATGATGCAAATTTCAGTACCAATTGGTTCGCTCGCTTCTTCATCAAGCTCTGCAGGCTGCTCGCCACTTTCCG
CTGTCGCTCCACGGCGAGTCTCAAGCGGACGTTGTCACGTTCCGCTTCTCCCCGACGCCGTTGCTGGCGCAGCGCCTGGTCCTGCCACATGCTGGAGATC
TGCGACTTGCAGTTCTTGGAGACCAGCGCGCAGTCCCTCAGCGGCTTGGAGCCATCTCGTCCCTGCTGCAGCGTGTACAGGTCGATCTGCAGCTTCTCGA
TCTGCTCGCGCAGGAACGCAATCTCCCGCGTCCGCTCGTTGCGCGCGCGGTTCGGGTCGCTGTAGATGCCAGCCTGGCGCAGCAGCTTCTTCCTCGCGTT
GGCCCTCGCCCTCTTGGCCAGCGAGTCTTCCGGCTTTCGGGGGGAATGCACGCCACCTGCCTGGACGTGGGAGCTCTGCGCGGAGGACGAGGGCTCGTCG
TCGAGCTTGAACTCCTCCACGAAGGACAGCGCCGCCTCGAGCGCGTGCTCGTCGTCATCGCCCAAGAGGAACGCCATCACCGGCGGCGGAATGCGAACGC
TTTGGTGAGTGAGCAGTACAGAGACCTGCAGGTTGTCTGTCCTGTCTCAAGAGATACGATACCACCGCGGCGGCGGTGCCTCCAACCGATGTTGGAAGTG
GACATGTGCTACATGCACTCGGCTCGCCTCAATGCTCTGTCGGCTAAGGTGTTTTCAATGCGTTCTCGATGCGCGAGGATGTTCTTTGCGGCGTGGACGA
CGAGGAAGTTGGTGAGAGCTCGCACGTTGTCGGGTCCGCAGGCTGCGCCTTCCtcttggtcgagcgagatgagtgagcacaattgcagctgggtcagctc
gttgtcttccgtggacgcaggagagcgcctcgtgattgcgtagcctcgaaagttgtaggccaagcctcgaagcagcttgtgcttgacctcgacgggcgtc
gcgtgggagacccagatcacgatgtcgcggtcggcttcgacgtagcggcgcactacttgcttcagcttgacgtcggcgcgggaattgttggagtagactt
ctttggagaagtcctcgataatcgtgtacggctcgtcgagactctGTTGGCATCGAAACGTTAGTTCGCTTTGGAGCCGAGCGAGATATTCGTCATGCAA
GCTTACCTTTGCTGCTTTTTGGTACAGGTTGCCGTTGCCCTGGTGCTTCTCCACGCCTTTGAAGTGGTCCCAGCAAGCCTGAGCAGCGTCCTGCATCGTG
AACGGCAGATCCTTGTACGTGGAGAACTCGATATATTTTCCCTCGACACCTTCGCGAACGTGGACATCAATAGGCGATGCCTCCATGTTTGCCAAGCCAT
TCGCAGCGAACACCGAGTCAACATCCCTGTAGGCTGCGTCAAGGTGGTAGAAGAGGTTGCGAAAGTCTCCGATATCCCCTCGAAAGTCCAGCACATCGAC
AGTGTTGCGCTGCGCGCAGCACGAGCTCACCAATGATGCGCACTCGTTTGTCTGGAGTAGCAACGCACAAGCCAGGACGGAGTTAGTGTTATTGCTAGCA
ACACAACTCCCCTGAGCCCTTACCAATTGACTCGATCGCTTGTTCATCAAGCTTTTCAGGTTGGTCGCCACCTTCTGCTGGCGCTCGACAGCGAGTCGCA
AGCGGATATTGTCCCGCTCGGCCTCCTGGCGACGACGCCGTTGTCTGACAGCCTGCTCTTTCCACATACCCCCTGGGACTGAAGTAGGGTTCCTCGCAAC
CAACGCAGTAGCGTTTGCTCGCCTCGCTTCTCTCTGCTCCTGGATTTGTCGAGTCTGCAAGACCTTCAGGTCCAGCTGCAGTCGCTCCATCTGCTCGCGC
AGGAACGCGATCTCCCTCGTGCGCTCGTTCCGAACGCGGTTCGAGTCGCCGTAGACGCCAACCTTCCGCAGCAGCCTCCTGCGTTCGTTGACTTCATTCT
GCCGCTTCCTCTTCTCCTCACTCGACGACAACGAGCGCTTCGCCGCAGCCTTGGACCCGACAGCTCGAGTCGCCTGTGGCGCAGTCTCTTCGTGGATTTG
CGGTGCTGCGTTGTCCGGGGGAGCAGGAGGGAGACTCGAGAGCTCTCCGACTACCGCGTCCTCGAACGAGAACTCCTCCACGAAGGACAAGGCCGCCTCG
AATGCTTGAGTGTCGTCGGCCTCCTCCATTTTACTCACTTGTCAGTCACCACGTACTAGTACATTGCGCGCGGCGAGCACACCTGAACGGAGCTCCTCAA
AACAGCTGTGAATCGCTGTCTCATAACTCGCGTGGGACGCGCAATGCAGATCAAGCGCCCAGCTCAGCTTCGCTTACCAAAGGACTGCACGCTATGGAAT
GTGTACTTTAGATTACTAAGAATTGTTCATTGTCATGCTCTTTGCCTCAGAGTCTGCTCGACGAGTGCGTTCTCAATTCGGTCTTGGTGTGCCTGCATCT
TGAGGGCTGTGCTGGCGATGAGGAAGTTGGAGAGCACGCGCATGTCCTCCGGGCTGTGCATGGTGGCAGCAtcttggtcgagcgagatcatcgagcagca
ctgcagctgcgagacctcgtggtgtggtgttgacgcggacgacctttttgtcacggcgtaacctcggagctggtacgtgagcccactgagcattttgtgc
ttgatctcggcaggcgacacgcgcgcgacccaaatgacgatatctcggtcaggctccacgtagcggcggaggacttgcttcaccttgatgtcagcatggg
agcgccgcgagaaaagctccttcgtgaactcctcgacaattgtatacggctcgtccagatcctGCATCGGAACATACGAACGTAAGAGCGCCGATACCTC
CTTGGCAATGTGTCTAGCTTGAAGTCACGTACCCTCGCGGTTTTTTCGTAAATTCTTCCGTTCCCTAAGTGCTTCTCAGAACCTTTGAAGTGGTCCCATG
TAGCCTCGGTCGCAGCACGCAGGCGGAAATGGAGAACTTTATTCGAGAATGCTTCGGCGTAGGTGCCGTCGCCACCTTCTCGAATGTGGACGTCGTCCGG
GGTATCCACCATGTTGACCAGTCCATTGACAGCAAACACGGCGTCCACTTCCTGGTACGCTGCTTCGAGGTGGCGAAAGAGCTCCTGGAATCCACCCATG
TCGCCGCAGTAGGCCAGCACATGAACAAGAGGATGTTGGACGCAGTTTTGCCTGATGAAGCCTGAGCAATCGTTCACCTGCAGCAGCAAGACACCAAGTA
CACGTAAGTGACTTGTCAGCTCTTCGCATACAGCACCACCGCCATCACCACGCCTCACCAATCCAGCCACCCGCTTTTGCAGTGTGCTAGTCATGCTATC
CGCCACCTTCCGCTGCCGCTCGACGATGAGCTTCAGCCGGATGTTTTCACACTCTGCTTCCTCGCACCGTCGCCTCTGGATGTCCAAGACCGCTTGCCAC
ATCTTGGGGTTCTGCGAGGTGTTGGCTGCATTTCGTTCTTGAGACTGTTTCGTATGCGCACTGGAGTGCCTACCCTTCTGCCTCTTCAACGTCTCCAAGT
CAATCTGAAGTTTCTCTATTTGCTCGCGCAGGAACGCGATCTCTCTCGTTCGTCCGTTGCGCACACGGTTCGAGTCTGCATACACGCCAGCCTTGCGCAG
GATCCTAGTCTTCTCGTTGATTTCCATGCGCCGCTTTATTTTCTCTTCACGCGACGTCAGTCGCACAGGGGCTTTGCATCGAGCGGACTGAACGACGGGC
GTCTGGTTGTCGATTGGTGTCTCGGAAGAGCTGCTGTCGTCCTCACTTGCAATCGAAAACTTGGTGCTCGAAGTGGACACCACCTCGTCGAGTGAATACT
CATCCACGAAGGACAGCGCTGCCTCGACAACCTGGTCGTCATCTTCGAGAAAGAACACCATGCCTCCCAATAGGGACTCGGAGGGCGTGTGCACGACAAA
TGCAAAGCATTTGTGCCTAGTTCGCACTCTGCACTGCTGTGTCGCATCCAGAGGGATAGCAATGATGGAGCCCAACCAATGCTTGTTGGCGGTGTGTGAG
GCGTCTTTGCTGCCGAAAGTTGGTCTGTCGACGCATGTACCTGTACATGTATTGTGCTTTGCTTTCAGTTTGCCCTGCTATTTCGTGGTTTTACATTATT
CGGGCGGGACGACGACGCCCTGCCGCCTTAACTGCTGGTCAACGAGGGCATTTTCGATGCGGTCTTGGTGCGCTATCATTTTTTGGGCGGCGGTGACAAT
GAGGAAGTTGGTGACAGCTCGCACGGTCTCGGGCCCGTACATGGCCTCCGCCTCCGGTtcgagggagatcagcgagacgcactgcagctgcgaaacttcg
tgttcgggggtcgatgctggcgatctcttggtcatcgcgtagcctcgaaggtggtaggtcagaccgcgcagcttcttgtgcttgatctcggttggttcag
cgatagagacccagatgacaatgtcgcggtcgggctccatgtagcggcggacgagctgctgcacctggatatctgctcgggcattcttggaatgcatctc
cttggtgaattcttcgaggatcgtgtacgggtcgtcgaggttctGTCGACCAGACAAGCAAGAGCGAAATCGTTAGAGTACGGAAGACGCACGCATCGTC
GGTATCTGCAGCGCGGCTTACCTTGGCAGTTTTTTGGTAGATGTTGCCGTTCCCTAAATGCTTCTCGCCCCCCTTGAAGTGGTCCCATGTAGCTTCAGTT
GCTGCGCGCAGTCCGAAGGGCAGCACCTTGTTCGAGAAAGCCTCGAGGTATTTGCCATTGACACCCTCGCGGATGTGCACGTCGCTGGGGGTGAGCACCA
TGTTGGCTAGGCCATTGGAAGCAAATATGGCGTCGACTTCCTGGTGCGCGGTTTCGAGATGACGGAATAGCAGCGGGAAGTCTCCAGCACCTCCGTGAGA
ACTCAAAACGCGGACAATCTGCTGGTTGGAGAAGTCCACGTTCATGAAGGTAGCGCAGTCGTTCGTCTGCACGCAAGAAAACACCGAAGGTTTAGAACCA
AACAACACAGCGTTTCTCTCGTTAAGAGAGGCCTCAGTCACAACAAGAGTCGAGTTACGCACCAAATTACCCGCTCGCTTCCGCACCAAGTTGGTCATGC
AGTTCGCCACCTTCTGCTGGTGCTGCACAGCAAGCTTCAAGCGAAAGTTTTCACGCTCCGCTGCCTTCAGCCGACGCTGCTGTCGAATGGCGATGTCCTC
CCAGACCTTCGGGATCTGCAGCGCCGAGTCCATTGCATCGTCCGTCGGTTCTTGAGCCTCAGTTTGCAGCGCTGGCTGTCTGGTCTTGCGGCTCTGCAGC
ACCTGCAGGTCGAGCTGGAGCTTCTCGATCCTCTCGTGCAGGTAGGCGATCTCCAGTCTGCTGTCCTTGCTCATCCAGTTGGCGTCGCCGTAGATGCCAG
CTTTACGCAGCAGCTTCTTCCTCTCGTTTGTCTCCGTTCGCCGCCTCAATTTGTCTCTGTTGGACGCTCCAGAGTTTTGAGCTTTGGCAGCGACAGCTGA
GACCGTCGGCGTCGTCTCGTAGCTGCCGAGGGCTCCGAATGACGCCTCGACTCCGGTGATGTTAACTGTTGGCGCCAAGCCGCAGGACATCGCGGCCCAC
TCATCCTCGCGCTGCATCAAGGCGGTGGTCCTGAGCGCTGCTGCGTCCTCCACCTCCTCATCGAGCACGCACTCGTCCACGAACGACAGCGCCGCCTGGA
ACGCTCGGGCGTCCTCGTCCTCGAGAGACACGGCCATGGCGGCAAACAGCTTTCTGCTTGCGAAGTCGTCTGGCGGTGTTCTTGCCACGCCAGACTCTGG
CACGCGCCTGTATTGTCTCTCCGCGTTGCAATGCTGGATGGCAGCCTGAACCTCAAGGAGCCACCGAGCAGCGCTAAAGAAGTACATGGTGTTGATGAAC
TACACTGTACTGCCCGACAACTTGCACACCTCCATTGCGCGTGTTCGTGGCATTTTTAAGACAAAGCATGCATAACTGCACCAACTAGACAATCGACCAT
CGTAGACTTTTCACTGTTACGCAATGAACCTAGCTCGCCAATAGTGCGTGGTCCATTAACGCGTTCTCGATGCAGTCCTGATGGCCTTGCATCTTCGCCG
CCAAACTCACGATCAGGAAGTTCGTGAGAGAGCGAATAGCATCGGCACCCAGCTTCGCCTCCGTCTCCGCgtcgaacgaaatgagagagcagcactgcag
ctgggacacctcgcactctggcgtcgacgcggaggatcgcttcgtcactgcgtagcttcggacttgatacctcaagccaccgagcatcttgttttttact
tcggcgggagatacgcttacgacggcgatcacgacgtctcggtccggttcgacgtatcgccggacgacttgcttcatgttggcatctgcgcgagcactgt
tcgagtgcatctccttggtgaactgttcgagaagcgtgtagggcacgttgacatcctGTTGAATACACCAAAGCGTCAGCAAAAACTACGCAGTTCATGC
GCGTATTCGCCTGCTACTCACCTTTGCAGTTTTCGTGTACACGGTGCCGTTGCCCATGTGCTTCTCGGAACCTCTGAAGTGCTCCCACGTAGCTTCCGTC
GCCTCCTGTAGCTTGAACGGGAGCACCTTGTTGAAGAACAACTCCACATACTTCCCCCCGACACCATCTCGTACGTGGACATCGCTTCGTGTGATCGCCA
TGCTGCCCAAACCGTTCGCTGTAAACACTGCGCCAAGCTCCTGGTACGCACTATCTAGGTGACGGAAGAGGCCTCCAAACTCGCCGAGATCTCCACGCAG
ATCCAGCACACTAGGATTCAAGCCATCCACGTCTGTGAAGAACGAGCACTCTGTATTCTGTAGAGTAAAACGTGAAAGTATCACAACGGGAAGCTCGTCA
GCCCACGTGATCACCTTCAACGCCCAACACATATGTCGTCCTGTTTCACTTACCAATTGACTCGCTCGCTTCTGCAGCAAGGAGCGCAGGTTATCCGCCA
CCTTCTGCTGGTGCTCGATCACAAGTTTCAGACGGATGTTCTCGCACTCCGCCTTCTTCCTGCGGCGTCGCTGGCTGTCCGCCATGCTCTCCCACACGGT
CGACATCGTCGGTGCGTTCATGGCGACAATGGCCTCTGCAGTCGGCACGTGGGCCTTATTGCGCTGCTCTGTCGATGGAGCAGCCCTCGTCTTCGTTCTA
CGCGTCGATCCCTCCCCCTTCTGCTTCTTGAGCACCTCCAGGTCGATCTGGAGCTTCTCCAGCTGCTCTCGCAGGTACGCGATCTCGATGCGGCGGTTGT
TGCGCACGTGGTTGGAGTTGCCGTAGACGCCTGCAGCCCGCAGCATCTTCTTCCTCTCGTTGAGCTTGTCCCTCCGCGCCATCTCGTCTTCGGTCACCGG
AGCTCGTCGAGGCGATTGACTCGTCACATGGCCACGGTCTCCGCTCGCTGTCACGGCCAATGGGGACGCGGGAGCCGGAGCGGAGACGCCCTGCGCAGCG
C