Description :
From Genome Similarity Track
Location :
Scaffold_2:710253- 714334
Sequence
4081 bases(100 bases per row)
CCCAGGCTGGCTCATCATAGCCGACCCACTTGACCTTGAACTTCCGCTGAGTTCTGGAGGTGCTCGTAGAGAGCGGCAACTCGTCGTCCAGGATGGCTTC
GACTTCGTATTCATTCATTGCTCGTCGGGCTCCCAGCTATCTTCAGGAAGGAGTTCCTCGTCAAAGTCGAGACGATCCGACTCGGCTAAGTCGGCTACTA
GCCTAGTTGTCGGCCGCTCGCCGAGTCCCGTGACCGCTTTCAGACGTGACACATGTATCACAGGGTAGAAACGGTATCCGCTCTTGTCCGGGAGTTCGAG
CTCGTAGGCAAACTCCTCCACCTTCTTCTTCACTCGGGATGGCCCATGCCATCGATGTGCTAACTTCTTGGTCAAGCCAGGTCTGACTCGTTCCATGAAC
AACCAAACTTGGTCGCTTTCCTTGAATAGTGACTTCCTCGACTCGGCTAACTCGTCACCTTCCTCAGTCGACTCGGCTGCTCCCTCGGGTGAGTTCGCTG
GGGTATCCGTCCCTTCCTCCCCGGCTGGGACAGCTCTCTGCGCGACTCGGCTGAGTCCGTCATTGTGTGCCTTCGCTCTCCGTTTCTTCTCCTTCAACTG
GAACTCGGCCGCAAGCTTCAAAGCCACCTCTCTCTGTCGGTTTGCTTCCCTGCGCCATTCGGCTGCTCCCGTTGAGTCAGCTGAGTTGCCCCTGCCGAGC
TTGACTGACTCGGTCATCGCCTTGCGTGTAGACCGAGCGTCCCATCCGTGTACCAGGTAGAACGGGTCTCCCGCCGAGTCGAGTCTCTCGAATTGTTGAT
GGCATGGACGAGCTTCTCGGCTACATCATCCCAGTCGGCTTGGAGAGGGTCTTCCACGTACACACGCACAGTCTGGATCATGGTCTTCGCTGAGCGTTCT
TGCTGACCGTTGGCTTGTGGTAACTCAGCGTCGCTCTCGACTTGGACTGCATCATCTCCGAGAACTTCTGGAACACTTCACTCATGAACCGGGTATCTCT
GTCGTGGCGTACCAGTGATGGAGCTCCAAACCTCCGGAACACGTTCTCTTCGAAGGCCTTCGCTACCTCAAGTGCCCCAGTCTCACTCATTGCCTTAGCA
ATCACGAACCCGGTGAAGTGGTCTTGAAACAACAGGAGTGCAGTGTTGCCCCGCCGAGTCTTCGGCAGTGGTATGACAAAGTCCGTCGATACCACGTGGA
ACGGTCGCTCAGACACTACGTTGCCAGGTGGATAGCCCTTCAGGTTTGGTTTGCTCTTACTGGCACTGCAGTCTTCGCGCGCTTGGACATGTTTGACCAC
GTCTGCGTACAACCCTAGTCGGCTCTGACCCTGTGGTATGTCCGCCTCCCTCGATGGAGTTGTGGCTGTTCTGCAGGACCTCGTCTATCATGGTCGTCGG
AACCACCAGTTGAAGGGATAAGCCTAGTTCGCCGAGTTCGCCAGGTGGTCTGGCCTTGCCTTGTCGGTACAATAGCCCGTTTTCGCTGAGCACAAACTCG
TCGGCAACTTTCCCAGCGTTGTGAGCTCGGCGATGTGTGAGCTGCGCATAATCCCCTCTCAGGTAGGTCTTCAAGTCGGCCCATCGTCGTTCCTCGTCTT
GAGCTCTTGCTATTCGCAGGCGGCGCTCAGCTTGGACCACTACCGGGTCGATGTCCATGGCGTTGGGCTCCCGGGCTTCTCCGAGCTCAGCTACCAGCTC
AGCTGGGTTAGCTGGTGGTGCTGCGCTACCGAACTCGGCTTCTCCCGTCACCCGCTGTCTAGCAGGCGGAGTTCGGCTATCTCGTTCAAAGTCATTACGT
TCGGCTTCCTCATCCGTAGCTGGGTCCGGGACCGGGTGTTCTGCCGCTTCGTCTTCGAAACGGACTCGGCGGACTTGACTCCTTGTCACGGCAGCCATCT
CAACACCCTCGGCCGGAGCTGCAGCCGAGTCCGTGTCTACGTACAGGACCTCAGAGATCCTGTTTAGGGTCTTCAACTCGGCTTTCCGTCCGGCGCTTAG
CACGACCTTTCCTGCTTTGGTTCCCAGTGCGTCGGTCGCTAAAGAGTCAGCTGCCGAGTTGTAGAGACGCACTACGTGGAGGTAGCGAACTGAATTCAGC
TTGCTGACCAATTTCTTGTGGCATGCTAACTCGACTTGCAATGCCTCCTTCTTACACGCGATCACCCCCATGGATTGCTGGATCGCAAGCCGGGAGTCGC
CCACGATGATCAAATCCGTCACCCCGCGCTCAATGGCCGAGGTCACCCCATTGTTCATGCCGGTGTACTCGGCTATATTCACCGTGGTCGATGGGAGGTG
CGCGCTCGCAGCGATCTCAATGTTCCAGTCTGGCAAACGCCACAGGATCCAAGAACCCCCGAACCCGCCGTGTTTAGCAGTCTTCGCCGATCCGTCAAAC
GACAGGACGTGTCCCTTGAAGTCTCGGGGCACATGCGCATACAGCAATTCTGGGTCCATGCGGACCACGGCCGAGTTCTTGGACGGTGGAGTGACATGCG
TTAGTAGCTCGCCCAATCCCACTGCCGGCGTGATGGACGCTTGGAGCAACTGGGCGAAATCCGTGTCCCGTTCGCGGACCCGCTTGACCTTTAGGTGGAA
CGGTGATAGCAGTACCGCAAAGCTGACTGCTCTGCCGTAGAGAGACTTCGACTGGAACACCCATTCGAGAGTCGAGTAGCGGGTGTAAACATGGATGGTC
TTCCCGGCGAGCAACGTGTGGCACACCTTGATGAGCTGTAGCAAGGCGAGAACTTCTTTCTCGGCGGGATGGTAGCCGAGTTCATTATCCTTGAGGACTC
GGCCGCAGAACCGCACTGGATGGAGCTTCCCGTCGTGGAGCTGCATCAGCGTGCTACTCAGAGCCCACTCATTGGCGAATAGCATAACGTGGACGTCCTC
AGCCGAGTTGAAGTGGCGGAGTATGGGTGCGTCGACCACCTGCTGTTTTAACTCGGCGAACGCCGCTTTTGCGGCCGTCAGATCACCGCTGGGTCCGAAA
TCTTCGTCCTTCAGCTGATAGAGGACCGCCCCATATACAGCCAGGCTCTGGATGAACCGGCCGTAATAGTTCAGCGCTCCTAAGAATGCTTGCATCCCCT
TCTTCGTCGTTGGGAACGGTAGCCCGGCTATCGCCAGCATTTTTTTCTGGTCGGCTTGGATTCCAGCCGAGGTCACCCCATGTGACAGGAAGTCGACTTT
AGGTTGGACGAAGGTACTTTTCGGGAAGCTGACGCTGATGCGGCATTCAGTGAAGCGTTGCAGCAATCGGTCAAGCGTCCCCAAGCAATCGTCGAACGTC
CTTCCACCGAAGCAGATATCGTCCGCAAACGATCGCCGGTCGAAAACCGGTGCAAGGCACGATTCATCAGGTTCACCCGTCCGGAACATGTCGGCTTCTG
GGCTGTTAATGAATTCTTCCAATGGGTCAAACTCAGCTTGAGCTCGGCGGTCGGCCTCAAACTTGGTCTGGCCACTGGCTTCAAAGTCGATGTCGGCTGC
GAGCCGTTTCCGCTGAGCTTCTGAGGCGGCTTCCGCTTGTTGGATGCGCTTGGCGAACACCTTCCAGCCTTGGGTTGTACGTAACCCCGCAGAGCGTTAT
CAATAAGGCGCTGGTAGATCATTGGAGCATTCTTTAATCCGAAGGGCATCCGCAGCCACTCGAAGTGACCAAGCGCGCAAACAAAAGCCGAGATCCAACG
CGCCCGTCGAGTCATCATGACCGCCCAGAAACCGCTAGCAGCATCCAAAGAGCAGAACCATAGGTACGCTTCCAACTCCGTGAAGAGATCGTCCACTAGC
GGCATGGCATACTCCATGAGCAACGTAATCGCGTTTACCAGCTTGTAGTCGATACACAACCGAATGTCGACCCCATTCTTCTTTAGGACAATCACGATGA
GTGATGCCCATGGGCTGTTCGAGAAGGCAATTAGCCGAGCCCGTAACAGCGCCTTGAGCGGCTCGTACAACTTGCCGAGATGCTTCAGCGGAACTCGGCG
GGCTCGTTGGCGGATTGGCGGATGCCCCTGTACGTCGATGTCACACACTACGCCGTATGCTGGTGGAGGTAGGGCATTACC