Description :
From Genome Similarity Track
Location :
Scaffold_197:71021- 75372
Sequence
4351 bases(100 bases per row)
GTAGCGGTTTACTAAAAGTTGAAAATGGACCACACCGTCCCACATTTTAAAATTTTAGTGAAGTCTGACGTTTGTTTTTTTATAAATTACATTTCATTAC
ATATTTACTATGTACCAGTATTCACTATGGGTCGTATAATACGACTCGTATTCTCCCACACTGTCCCTTCACCAGTGGTTTTACATAATACTGTACTACG
TTTTAACAGAAACTGTGCCTTTTGTTAAAAAAAAAAAGTAAGCACAGTTTCAAAAAATGAAATGCTTCGTCAACAATGATGATTGTCTCACCATATGGAA
CATGTGGGTGGCGTACGAGTCGTACTGATTACGCAGCAAAGAGGTCCTGTACATGTACAGGACCTCTTTGCTGCGTAATCGGTGAGTGAACAGCTAACGT
ACATTGCTTCCACTTAACCATTCGCCTCTCATTACATTAACATGACTTCTCCTGCGATGAAAAGCAGCTGCCTATACCCGCCTAACAACCAGTATGTAAG
CGATGCCGTGGTCCGAAATGTGGTGCAACGGACAGTTCCTCAGACCAGCCAACCTTCGAATCAACGGCAAACAGAGTCGACTATACAACCCCCGGTCGAA
TCATTCACGCGTGAGGTGGCGAGGGGCCACGCTGGTAGAACAAGAGCAGCTAAACTAGCAAGACCAACTCGATGGAGGTCTCATACGACGCTGCACTTAC
GTTGTACCACAAGCGATACCCGAAGGAAAGACACCACCTCGATGAATAATGAAGCACTTATGACTAGTGACCCAGAACGAGAACGCCATCGCCTAACCAA
GAGCGTTACAGAGCGAAGCAGAAGAAGCGCGTGACAGACCTTGAGGACGACGTGGGAGCACTTGCGAGTGAGATCGAAGATCTCAACGTCCAACTTCACT
GGGTTTCCAGCGGTATATCTACTAAGCAGACTGTCTGGGGTGTTGCTACCGAGTATTTCCGCCTCTTTCAGTACGGCTTGTCCGGAGGAGCACTATATGA
ATACGCGATGAGTTTCTTGCAGAAATCAATGTCGCCGGGCGTGGCAGACGGGTTCGAGTACGGGCCGGAAAAAATGCTAGAAAATTTGAGATTGCTATCA
CTACTCTTCGACGGTTTTAATGTCAGACTGAACGGACTCATGGAACTTGGTACACATTCAGTAAACGCCATCACGACTACAAGAATCACCTTTTCCAAGA
GCACGCTGCTAAGGGCATTTCCTCTCTTGGACAGTAATGAGGTTGAGCTGTCCTCACTAGCCACTAAACTTAACGGCAAGACACTTGCCTTGCGCGGCTC
GGTGTGCTTTGACTGGGACGATAAGAGTGGGTGTGTAGTTGGTATCTACAGTCAATCAGATTTACTGACGCCTCTGCTTCGCATGCTGGGAAATCTGAAC
GACGTCGCACGTGTATTTGACGGTGCTTTGGTCACACCGGGGTTTAGAGTAGCTGCGAAAGCCAGGAATAATGCTGCACTTTTGAATGCGGCAAGGTGTT
GCTTTCGACCAACTTCGAAGCTGGGATTCGGACATTGACGAAGAAGAGCTGTAACTACACGGCTCCATAACAGAAATACAATCCCGTTGCATTATTATTT
TGCTTGGACACACAATAAATAAGATGAAGAACTACTAAGTACTCGTACAGTATCTTCAGCACTTACTAGTTCACGTACTTCAAGTATTTTTTCGTACATG
AGCACTTAATCCGACATGCTGCACCCAAGCTTGCTATCACACAGCAGACTGCAAACATTTGGCTTGAATTTCACAGCTCATCATAATACAGCTGGCTAAC
GATGTCAGATACAGTGTCATGTGATTTTGTATCCCATAACGGGGACCCCAATAAAATCACTAAGTGAGAGAAACACGAATGATGAGAAGTTTGCGAGCGA
TGTGATCATCGTATGATCATAATCACGTTGTTCGCAAACGCGCAGAGGCTCGTATACCTGCCTTTCCTTCAGACCGACTTTCTAAATAGGAACGCGTCTG
GGTCACAGTTTATTAACGTCGGAGATTGACACACTCGAGCGTGCGATGGATATTTGGTCTTTTCACCCGCCCAATTACCAGTCACTCAGCGACAATGTGA
TAGGCAGAGTGGTGCAGCGTACCCAATGCTCCCGAGACCGTCGGCTTTTCAATATCAAAGTGAAGGACAGAATGGCTTCACCACTTCCCGAACAACGAGG
TTCAGCACTGCTATCGTTCGCAGTGATATCAATCCAACGGCGATAAAGTTTTCAAAACCGAGTAGCACCCGCAAGCGTTCGCGGTTCCTCGAAGACACCG
ACGACCCGGTTGCTACACAAGATACTGAACCCCTGTCTCGTGTTATCCCCGATCACCAACGCAGCATGTCTGTTCGAGAACGCCGTCGTCAAAAACAGAT
TCGTTATAGAACAAAAAAAACGGACTTTTGATGGAGTGTGAGGAGGATATTCAAAGGCTTCGTGAAGAAATTTCAAGATCTTGAGGTGCGGCGTCACAAT
TTTTCGTCTACCCGGACAATATGGGACGTTGCCACTGACTCTTTCGTCATGGCTTCGTCCCTAAAGCGCTACGTAGTTACTGTGAGCGCTTTCCTGCAAC
AATATATGGGATCAAACATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN