Description :
From Genome Similarity Track
Location :
Scaffold_2:710209- 714331
Sequence
4122 bases(100 bases per row)
GTAGTCGAACAATAATCCCCCACACGACAAATTCGACAGCGGCTCCCAGGCTGGCTCATCATAGCCGACCCACTTGACCTTGAACTTCCGCTGAGTTCTG
GAGGTGCTCGTAGAGAGCGGCAACTCGTCGTCCAGGATGGCTTCGACTTCGTATTCATTCATTGCTCGTCGGGCTCCCAGCTATCTTCAGGAAGGAGTTC
CTCGTCAAAGTCGAGACGATCCGACTCGGCTAAGTCGGCTACTAGCCTAGTTGTCGGCCGCTCGCCGAGTCCCGTGACCGCTTTCAGACGTGACACATGT
ATCACAGGGTAGAAACGGTATCCGCTCTTGTCCGGGAGTTCGAGCTCGTAGGCAAACTCCTCCACCTTCTTCTTCACTCGGGATGGCCCATGCCATCGAT
GTGCTAACTTCTTGGTCAAGCCAGGTCTGACTCGTTCCATGAACAACCAAACTTGGTCGCTTTCCTTGAATAGTGACTTCCTCGACTCGGCTAACTCGTC
ACCTTCCTCAGTCGACTCGGCTGCTCCCTCGGGTGAGTTCGCTGGGGTATCCGTCCCTTCCTCCCCGGCTGGGACAGCTCTCTGCGCGACTCGGCTGAGT
CCGTCATTGTGTGCCTTCGCTCTCCGTTTCTTCTCCTTCAACTGGAACTCGGCCGCAAGCTTCAAAGCCACCTCTCTCTGTCGGTTTGCTTCCCTGCGCC
ATTCGGCTGCTCCCGTTGAGTCAGCTGAGTTGCCCCTGCCGAGCTTGACTGACTCGGTCATCGCCTTGCGTGTAGACCGAGCGTCCCATCCGTGTACCAG
GTAGAACGGGTCTCCCGCCGAGTCGAGTCTCTCGAATTGTTGATGGCATGGACGAGCTTCTCGGCTACATCATCCCAGTCGGCTTGGAGAGGGTCTTCCA
CGTACACACGCACAGTCTGGATCATGGTCTTCGCTGAGCGTTCTTGCTGACCGTTGGCTTGTGGTAACTCAGCGTCGCTCTCGACTTGGACTGCATCATC
TCCGAGAACTTCTGGAACACTTCACTCATGAACCGGGTATCTCTGTCGTGGCGTACCAGTGATGGAGCTCCAAACCTCCGGAACACGTTCTCTTCGAAGG
CCTTCGCTACCTCAAGTGCCCCAGTCTCACTCATTGCCTTAGCAATCACGAACCCGGTGAAGTGGTCTTGAAACAACAGGAGTGCAGTGTTGCCCCGCCG
AGTCTTCGGCAGTGGTATGACAAAGTCCGTCGATACCACGTGGAACGGTCGCTCAGACACTACGTTGCCAGGTGGATAGCCCTTCAGGTTTGGTTTGCTC
TTACTGGCACTGCAGTCTTCGCGCGCTTGGACATGTTTGACCACGTCTGCGTACAACCCTAGTCGGCTCTGACCCTGTGGTATGTCCGCCTCCCTCGATG
GAGTTGTGGCTGTTCTGCAGGACCTCGTCTATCATGGTCGTCGGAACCACCAGTTGAAGGGATAAGCCTAGTTCGCCGAGTTCGCCAGGTGGTCTGGCCT
TGCCTTGTCGGTACAATAGCCCGTTTTCGCTGAGCACAAACTCGTCGGCAACTTTCCCAGCGTTGTGAGCTCGGCGATGTGTGAGCTGCGCATAATCCCC
TCTCAGGTAGGTCTTCAAGTCGGCCCATCGTCGTTCCTCGTCTTGAGCTCTTGCTATTCGCAGGCGGCGCTCAGCTTGGACCACTACCGGGTCGATGTCC
ATGGCGTTGGGCTCCCGGGCTTCTCCGAGCTCAGCTACCAGCTCAGCTGGGTTAGCTGGTGGTGCTGCGCTACCGAACTCGGCTTCTCCCGTCACCCGCT
GTCTAGCAGGCGGAGTTCGGCTATCTCGTTCAAAGTCATTACGTTCGGCTTCCTCATCCGTAGCTGGGTCCGGGACCGGGTGTTCTGCCGCTTCGTCTTC
GAAACGGACTCGGCGGACTTGACTCCTTGTCACGGCAGCCATCTCAACACCCTCGGCCGGAGCTGCAGCCGAGTCCGTGTCTACGTACAGGACCTCAGAG
ATCCTGTTTAGGGTCTTCAACTCGGCTTTCCGTCCGGCGCTTAGCACGACCTTTCCTGCTTTGGTTCCCAGTGCGTCGGTCGCTAAAGAGTCAGCTGCCG
AGTTGTAGAGACGCACTACGTGGAGGTAGCGAACTGAATTCAGCTTGCTGACCAATTTCTTGTGGCATGCTAACTCGACTTGCAATGCCTCCTTCTTACA
CGCGATCACCCCCATGGATTGCTGGATCGCAAGCCGGGAGTCGCCCACGATGATCAAATCCGTCACCCCGCGCTCAATGGCCGAGGTCACCCCATTGTTC
ATGCCGGTGTACTCGGCTATATTCACCGTGGTCGATGGGAGGTGCGCGCTCGCAGCGATCTCAATGTTCCAGTCTGGCAAACGCCACAGGATCCAAGAAC
CCCCGAACCCGCCGTGTTTAGCAGTCTTCGCCGATCCGTCAAACGACAGGACGTGTCCCTTGAAGTCTCGGGGCACATGCGCATACAGCAATTCTGGGTC
CATGCGGACCACGGCCGAGTTCTTGGACGGTGGAGTGACATGCGTTAGTAGCTCGCCCAATCCCACTGCCGGCGTGATGGACGCTTGGAGCAACTGGGCG
AAATCCGTGTCCCGTTCGCGGACCCGCTTGACCTTTAGGTGGAACGGTGATAGCAGTACCGCAAAGCTGACTGCTCTGCCGTAGAGAGACTTCGACTGGA
ACACCCATTCGAGAGTCGAGTAGCGGGTGTAAACATGGATGGTCTTCCCGGCGAGCAACGTGTGGCACACCTTGATGAGCTGTAGCAAGGCGAGAACTTC
TTTCTCGGCGGGATGGTAGCCGAGTTCATTATCCTTGAGGACTCGGCCGCAGAACCGCACTGGATGGAGCTTCCCGTCGTGGAGCTGCATCAGCGTGCTA
CTCAGAGCCCACTCATTGGCGAATAGCATAACGTGGACGTCCTCAGCCGAGTTGAAGTGGCGGAGTATGGGTGCGTCGACCACCTGCTGTTTTAACTCGG
CGAACGCCGCTTTTGCGGCCGTCAGATCACCGCTGGGTCCGAAATCTTCGTCCTTCAGCTGATAGAGGACCGCCCCATATACAGCCAGGCTCTGGATGAA
CCGGCCGTAATAGTTCAGCGCTCCTAAGAATGCTTGCATCCCCTTCTTCGTCGTTGGGAACGGTAGCCCGGCTATCGCCAGCATTTTTTTCTGGTCGGCT
TGGATTCCAGCCGAGGTCACCCCATGTGACAGGAAGTCGACTTTAGGTTGGACGAAGGTACTTTTCGGGAAGCTGACGCTGATGCGGCATTCAGTGAAGC
GTTGCAGCAATCGGTCAAGCGTCCCCAAGCAATCGTCGAACGTCCTTCCACCGAAGCAGATATCGTCCGCAAACGATCGCCGGTCGAAAACCGGTGCAAG
GCACGATTCATCAGGTTCACCCGTCCGGAACATGTCGGCTTCTGGGCTGTTAATGAATTCTTCCAATGGGTCAAACTCAGCTTGAGCTCGGCGGTCGGCC
TCAAACTTGGTCTGGCCACTGGCTTCAAAGTCGATGTCGGCTGCGAGCCGTTTCCGCTGAGCTTCTGAGGCGGCTTCCGCTTGTTGGATGCGCTTGGCGA
ACACCTTCCAGCCTTGGGTTGTACGTAACCCCGCAGAGCGTTATCAATAAGGCGCTGGTAGATCATTGGAGCATTCTTTAATCCGAAGGGCATCCGCAGC
CACTCGAAGTGACCAAGCGCGCAAACAAAAGCCGAGATCCAACGCGCCCGTCGAGTCATCATGACCGCCCAGAAACCGCTAGCAGCATCCAAAGAGCAGA
ACCATAGGTACGCTTCCAACTCCGTGAAGAGATCGTCCACTAGCGGCATGGCATACTCCATGAGCAACGTAATCGCGTTTACCAGCTTGTAGTCGATACA
CAACCGAATGTCGACCCCATTCTTCTTTAGGACAATCACGATGAGTGATGCCCATGGGCTGTTCGAGAAGGCAATTAGCCGAGCCCGTAACAGCGCCTTG
AGCGGCTCGTACAACTTGCCGAGATGCTTCAGCGGAACTCGGCGGGCTCGTTGGCGGATTGGCGGATGCCCCTGTACGTCGATGTCACACACTACGCCGT
ATGCTGGTGGAGGTAGGGCATT