Description :
From Genome Similarity Track
Location :
Scaffold_498:7102- 8241
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_498-fgenesh-gene-0.1Nitroreductase family

Sequence
1139 bases(100 bases per row)
CGGGCTCGTGACGTGTCCTATGGAGGGCTATGACGAGCTGCGACTCAAGAACGCGCTCGACATCCCGGACCGGTACTCGGTGCCGGTCGTGATCTGCTGC
GGGTACCCGAAGCCAGGGACTGAGCGCGCAGACACGACACCGCGACTGGCGCCGACGGAGATCTTCTTTGACGGGAAGTTTGGCAAATCGAGCGAGAAGC
TTTTTGAGTAGAGAGAGAGAGACGTCAGTACGGTACATGGAACAGGGAGAAGGACGAAGACGATGAGAGGGCGGCCTTTTTGGTGGAGCGGGAGCATGGA
TATCCATCCATCCATCCATCCATCTATCCGTATCAAAACAAACCAAAAAATATAGCGAAGTGCTAGCTACAGTAGCTAAGCGACAAAGTTGCAGTAAGAT
CACAACCCAGATGTTTGTCTTGAGCGGCCGCGGATGTTCACCTTGTTAGTTAGTTAAGATGAGGCATATTATGTTACGCCACGCGAACGAGAATATCCAT
TCTTCTAGCTACACTGCTTTCGCAATGATGTTCACCTTGTTAGTTTGACCCTTTCTTCGTTACTAAGCACGACGAGTCGAGTCGGTGATTGCCAAACAGA
TTTTGTTCAATTTCTCGAGCTCCTTGTTGTCGGTGATGTGATAATACAGCGATTTCCCAGTAGCGCTTCGTAGATGACCATCCCAAACGCGTACACATCT
GATGACGTTGGACTGGGCAGCTAACCTTGAACGGTCTCTCTCAGGCGCCGGCCACTTGGCCGGTTCTGCGATTTCGATTCGTGACCCTGGGTCTCCAGCG
CAGCCCAATCGAATGCGTACTCGAAAGATACTGACGTTTGACTTCAGGATGGGATTGTCCGAAACAGAGAAGTCCTCGCATTTATCGTACGACCCCTCGG
GCTGCACGAGCGGGTAATTCAAACGCGCGATCTCGAAACAACGAGCACAACGGTGTGTGTGTCCTGCCAAAGGTCTTGTCTTCAAGTACTTTGAAGTAGC
AAGCAAGTGCCGTGGACGCTGCGAAGATTCCGGGTGATCTAGCTTTCGCCAGGCGTTATTGTCATTGCGGATAAATGCTTACTTGGTGGCCTCGCTCTGA
CCAGCCGAAACCGAAAACTGGACATTTTCCACAGCCACT