Description :
From Genome Similarity Track
Location :
Scaffold_30:710190- 727581
Transcript NameFunction/comments
Physo_108776Os09g0407900
Physo_156909Tobacco mosaic virus helicase domain-binding protein
Physo_134287elongation factor P
Physo_134288hypothetical protein
Physo_156914hypothetical protein
Physo_156915hypothetical protein
Physo_156916predicted protein
Physo_156917AGAP000171-PA

Sequence
17391 bases(100 bases per row)
CGATGTCCGCCACCAAGAAGCGCAAGGCCGACGCGGACGCCGCCGCGGACGCCGGCGCCAAGCGCCGCAAGTGTCCGTACCTGGACACGATCAACCACCA
GCTGCTGGACTTCGACTTCGAGAAGGTGTGCTCCATCAGCCTCTCGGACCAGAACGTCTACGCGTGCCTCGTGTGCGGCAAGTACTTCAAGGGCCGCGGC
CGCAACACGCACGCCTTCACGCACTCGGTGCAGAGCAGCCACCACGTGTTCATCAACCTGCAGACGGACCGCATCTACTGCCTGCCGGACAACTACGAGG
TCGTGGACAACACGCTCAAGCCCGTGCAGGACGCGCTGCGCCCGGCCTTCGAGCCCGAGCAGATCGCGCGGCTGGACCAGAACCGCATCCTGGCGCAGGA
CGCCTTCGGCGTGTCGTACCTGCCGGGCTTCATCGGTCTCAACAACCTCAAGCACACGGACTACATCAACGTGGTGGTGCAGGCGCTGGCCCACGTGCCG
CCGCTGCGCGACTTCTTCCTGGCCAACGCGGCGACGACGAAGAAGATCAAGTCCAAGCTCGTGTTGCGCTTCGGAGAGCTGCTGCGCAAGATGTGGAGCC
CGCACAACTTCAAGAACACGGTGCGTCGCGTGGAATTGAGAGAAAGGTTATTTGTTGTGCTGTTTGCGTGTGCTGATGTGCGTTGCTTTGCTCGGGTGGG
TGCAGATCAGTCCGCACGAGCTGGTGCAGGAGATCTCGGTGAGCAGCAAGAAGAGGTTCCACGTGGGGACACAGAACGAGAGTGTGGAGCTGTTGGCGTG
GCTGTTGAACGAGCTGCACAGGGTGAGGTGCAGGCTGACTTAGTTGGCGGCTAAAGAAACAAAGTTTTGACGGGGTTGTCTGATTCAATGCATTGTCAGG
GCCTGGGTGGATCGCATAAACCTGGTAGCAGTATCATCCACAAGTGCTTCCAAGGTTTTGTGGAGGTCACGACGGATGATGAAACGAAAGCCGCGTCGGC
AGACCCAGCGGAGCGCGAATCCGCTGTTTCCACCACGGTATCGCCGTTTTTGTAAGTTGCTACGCGCTTAAGCTGTTGTCCGTATCTGGCTTCCGCTGAA
CATTGTTGCTACGTTTGTAGGATGATGGCGCTTGACTTGCCGTCGACGCCGCTGTTCAAGGACTCTCAAGGTGGAAATATCATTCCTCAGGTGAGATTAA
AGCAACGCCCTTGTGCATAAATGAAGGAGTGACGAACTAACAAGGTCATTGGGTGAATGGGGATAGATTCCGCTTTTTACAGTGCTTGAAAAGTACAACG
GCTCGCACGTAACGCACGTGCTTCAAGGCTCTCATCGTCTGAAGAAGACGTACCGCATCGACTCGCTGCCAGCGTATCTGATCTTCCACGTGAAGCGCTT
CACGCGGAACAACTTCTTCATTGAAAAGAATCCAACGATTGTAACCTTTCCGGTGAAGAATCTGGAGCTGCGTGATTACTTGAAGCTGGATCAGAGCCTT
CCGTCGGAGGAAGAGCTCCGCAACAAGTACGTGTGGCGAAACCATATCTTATCTTGGTATTCACTGATTAAATTCGGAACATCGATGCTGTTCACAGGTC
AATCTCTGAGCTCCGAGATATCCTTCGCAACCACAAGCAGTCCACGGAGGTGCGCTTGTTGTTTGCTGTTGGGCGTACGTGCAGAAGATAGCTGAATTAT
TGCTTGGTATAGGATTGCGTGGAAAAGGCCGACCTTGTCGAGAAGATTTTGCGTGTCACCCTGCCATCCACCAAGTACGTATCGCTAGCTAGCGTCGTGG
GGGTGAGTGAGGGCTTAACGTGGCTGTGCAATCTGTTTTTGTGTCGCAGGTACAACTTGATTGCCAATATCTGCCATGACAGCCCGGTGACAACAGGCCA
GGAGGCGGCGCTCCAAACGAACCCGCTGACGGAAGGCAGCTATCGCGTCCATGTTCAAAATAGAGTACGTGGCTGATGAACATGCACATACTTGACACAT
GGTTAAGCTGATGTATTGTATGTTGTTCATCTGCCGCAGGCAACTGAGCAATGGTACGAGATCCAAGATCTCCACGTCCAGGAAACGATGCCTCAGCTTA
TCGGTGTGTCCGAGTCCTACTTGATGATTTACGAGCGGAAGGCCTAAGCAACCCCGGAAATATAGCAACGAAGCCTGCGCTCGTCATACTGCAGACACCC
CATATTGTTCATTCCACGAGACCAAGGCCTCTATTGTTGTCGTGGACACGCTCGGCCGAACCCGCATAAGCGCCACCTGAAAGTCGGATGCATTGATTCC
TCGCACATCTTCAGCTTTCACGTTCGCCACTTTAGCTCCGAGTTCGCGAATAGGACCCAAAGCGGCATCCTTGCACACCGCCTTGAGATCGCTGCCAGAG
TAGCCTTCTGTTGCCTTGACGATGTGCTTAATATCTTTGGACGATAACGAGAACTTCTGGCTGCCGAGCAAGTGCCGGATGAGTCCTTCGCGAGAAGGAG
CATCTGGAAGGGGCACTGCCAACGACAGTGACAGCGTGCGTCAGGAAATAGGTTAGATGCGCTTGTCTTCAAGGTGGCGGTTAGAGGAACCACGTACCAT
AAATTCGCTTCTCCAGACGACGCACGATGGCCTCGTCGAGCTCCTGAGGGAGGTTCGTAGCTCCCATGACGAGGATCCGATCCTCCTGCGATGAAGCTGC
TCCATCGAGCTCAGTGAAAAACTGCACCAGCAAGTATTAGCAGTCAGGTTGCTGCGATGGACAACCCGATCTACTTTCAGTAACGCTACTAACCTGGTTC
TTGATTCTTCGGCTTGCTTCGTTTTCGGACGCTGATCTTGTCGACAATAAGGCGTCGATCTCATCCATGAAAACCACAGACGGCTGGAGCTCCCGGGCCA
TCTCAAACAGTGCGCGAACCAGCTTCTCGCCTTCACCCACCCACTTCGACGTCAACGACGACGCAGAAATGCTGCACCAAACATCCTTCAGTAAGGCCCA
ACACTAGGGCTGTGCATGTCACCATTAACTTACTTGAAGAATGTTGCTTTCGCCTCCGTAGCGACAGCTTTCGCCAGCAACGTTTTCCCTGATGCAATAA
CACCACACAAAGCACTATCAGTCAACACCCACCGACAGATTCTCAAACTCAATGGCGAAAGTTTGCATGCACGTAAGTAAGTACCTGTTCCCGGTGGCCC
AAAAAGCAATACGCCGCGTGGTGGGGCTCGCAATCCTGTGAACAAATCCGGTCGCAACGTAGGCAAAATGACAGCCTCCTACAGCAATCCCCCACATATA
TGCCGTCATTCAATGATCTCCAACAACAAGAAACAAGCTGCTGTCCAAACCTGCAAGATCTGCTTCGCCACCTGCAGCCCCGCAATATCACCCCAATGCA
CTCCAGGCGAGTGGTCCAATACCTCGTCCAGAATTGTGTGCGCATGTTCAGCATTCTGCTTCGAGTACCCCGCCTTGTGGTGCTATCAACAGCACAGATG
TCAAATGTTATCACTAAACACCTTATTTTCCACACCACCAGCCCTCCAACCTGCCGTCCACTTGCAGTGCGTGCATTGCCGTCCTGCACACTCGATGTAG
ACGCGTCCTACACGGGGGTAAAAAGGCAGCTCAGTGAGCGTCCCTGCTTGGGTTCTCATTGCCGCTGCATCATCGTTTCCAACCTGAGTTTGTGCCTGCT
GCTTCCGCGCCTGCTCCGCCGTCCAGTCCTTGAGATACTCGGCTCGCACCATGTACTCGTTGATCTTCTGGCGCAGCTTCGTCTTGGCCTCGTCGTCCGG
CAGCTCTGCACATGACAGATAAACGGCCTTAGCGGGAGGTTCAGGTGGCGGATATTTCGCGCTTCAACGTACGCCCCAGCTGCGCCATCATCTTCTCGAT
GCCCGAAGCATAGAGATCGATCGCTTCCTCGTATTTCCCTGCTTTGTCCGCCGCCACGGCCGCCTCGATGGCCTTCTGGATCGCGTCCTCGGGGCGCCGA
CCCCGCCAGAGGAACATGCTCGGCGAGGGATATTTCTTCAATAGTCAAGTGTATTGAAGTAGAAAAAATCCGGCGGATAGTTTCCGCGCTGATTTGGATA
ATATCGTTTCGAATTTCACCCTATCCTTGACGTGTTGCAGATACATTTCTACCAATGAATGAGCTTCAAAACGTGAGACCGCCAAATCGATACTTTGGGG
ACGTAATGATGTTGCGGCGAGCTATCACGCAGATCGCGCGGGCGACGGCTCCCGCCCGCGGCTACGGAGTGCGCTTCGCCTCCATCAATGGTACTGCTTT
GTTCGCCACTCCACGCGCCCTTCGACCGTGTAATTTTCGTCGTCTAAATCGTTGGAATCGCTGCGCTACAGGCAACCAGGTGCGCACGGGCATGGCGCTC
GAGATCGACGGCAAAATCTACCGCGTGGGCAAGAACCAGCACGTGAAGCCCGGCAAGGGAGGAGCTTACGTCCAGGTGCGTTAAATCGCAGCTTGTTGCA
CGAAATTTGGAGCAGAACCGCGCGAGATACGAGCTCACCGGTGCGGATCATTCATTGACAGGCGGAGCTGAAGGAGATCAAGACTGGTGCCAAGATGAAC
CGCCGCTTCCGCGCTGCAGAGACCGTGAACAAGGCGCCGCTGGGCCCCGATGAGCCGTTCCAGTTCCTGTACTACAATGGGGACCACCTCGTCATCATGC
ACAACTCGACGTTCGAGCAGGTGCTGCTTGCTTCTGTTGACTGTGCAGGGTGCCGACGTTGATCTAACAGGCTTCTTGCTGCTGCTGCTGCTGTTACTAC
TGTTGGTAGATGGAGATCGAGCGTGACCTGTTCTCGGGCCGGCAGCTGGAGTTCCTGCAGGAGGGCATGACGCTGTCGCTCCAGATCATCGAGGGAGACG
TGCTGTGGGCCAACATGCCCGAGCACGTGACGCTCGAGGTGACGGTGAGTGAAGTTGCAGTGTGGATCTTTCCTCTGGTCGAGGTTTGAACGTCTTCCCG
AATGTTGAACCATTGTCGTTTCAACCTCCGTCCTGCTCGCAGAAAACCACCCCGAAAGGCGTGGCGGAGAATGCGCTGAGCGTCAAGGATGCTACGCTGG
AGAACGGCGCCGTCGTCAAGGTACCGACCGCTGTTCGTTCATGGAATTGGGAGTAAAGTGCATGCGGGACTGACACGTTCACGTTTGTTCTGTTCTACAA
GGTGCCGCTGTTCATCGAGATCGGCAACAAGGTCAAGGTGTCGACCGAGGACGGCTCGTACGTCGACAAGCTCTGAGACTGCATGCGTGCATCTGTGGCG
GCGGTCGGCGCTACCGTGGGTGCCCGCGGTAAGGCGGCCGACTTAATGCAGCAGCGACGCTGCGTGCCAACAGAAGAGACGGCCCGAAACAATGACGATG
CGTCCGCATGGACAACGTTTGATCTGATTGACGACACCTTTGGTTCACTTGCCCATTTGACAGTTTTGACGCTGGCGCCGACTTCGCTGGAATGGCCTGT
GCAAACCACAGCGTGCGCGCCATGGCTTGACGTGCATGGCCGTCATTCTCGTTGCAGTGCAGCATGCATCTGGGGTATCAGCAATGCTGCTCGGCCCGTT
CCCGCCGCCTTCGCCGAAGAGCGCGCTGAAACCGCCTCGGGTGTCTACACGTCCTCAGGGTCCTCTCCGCCAATCGTTGAAGATCGAAGCGAGACGCCTC
CAAACTTCACGGTTTCGCCTCTGAACCATGCCTCGCCGCCATACTCGGCGCGAGTGTGCACAAGTCGCATGCCCAGATCGCAGTGCAGTGCAAGAGTTCA
GGTCGCCGAGCTGTGACTTGACTGGGGGGTGAACGGCGGAAGAGGAGGCGCCGAGGAAGCCTCGAGCCGCACCGAGCTGAGTCGTCGCTAGGTATCAGCT
CCGAGGTGTCCTCCTCGAGGCCGGCACAGTGAGAAAAATCGGCCTCCACGTTGCCGCGCCTGATCCCCTTCTTCCGACAGCGTCACTGGCTGTGTGCACG
CAGACGCATCCCGTGCGACCTCTCGCGGCTACAGTAGCGTTGCGCGCGTCTGGGCGCCGGGCTTCCGCGCCATTTATCCTTTGCCCCAGCCACCCGCACT
CCTCCTCCTCCCCCGCCTCCTCCGCCCACCAGCAGCAGCAGGCAGCACAATGGCCAACTCCAGCTCGACCGAGAAGGTCGCTCCGCCCTCGACCCAGCAC
CAGCACCAGCCCGCGGGCGACTGCCCGCACGCCGTGGCCTCCACCATCATCCAGCGGCACCGCGACAACCGCCAGCGCTTCGACTCGGCCGACTACGAGA
TGGCGCGCCGCGCCGCGGGCCCGTGCGCCGGCTGCACGTGCGGCAAGTGCGCGCCGTCGTCGGACGGCACCGACCTCGAGCGGGAGCCCGAGCCCGGCTC
GGCCGAGCACCGCGAGCAGCTGCGGTGTCTGCGCCTGCAGCGGTTCGACTCGGCCGACTGGGCCATGCAGGTGCAGCACGCGCAGCAGTCCCCGCAGACC
GACTCGCCCCCGACAGAACCCGCGAACGTCGCGCAGATGATCATGGACCGACACGCGCTCAAGACGTGCGCGCTCGTCGGCCCGGCGCCCGTCAAGAACA
GCGCCGACGCCCAGGCATAGGCCTCGATGGAAGAGGACAGATTCTTAGCCTCCCTGTAGCTACTACCCCCATTTAACGGCACCAATGTACACCACCTTAT
CTACTCTCTCGGTTTGGCCGGCATCGTCAATGGAGCATGCATAGACGCGAAAACATCGAAAAGTATCTTACAAGACCTGCGTCCACGTGCAGAGCCCCAG
GCCGTTCCTCCCGCCTTGCCCTGGTTGCTTCGAAGCGCTTGACCGTCCACGCGTGGAGGTCATTACGCGAAGGCCGCGCACTGATTCTGCTCGGGAAGAT
CCGCCCTTCGGTCCGGTCTCTGCAAGACTCGCTTCTTCGCCTTACGCATTCCCGCGGAGCGCGGTCTCGCGCGGCGTGTTGGCAAGTGAGACAGGAGTCG
CAAGAGGAGCAATCGTCTCTCCGGCCCGAAACCGTGCGAGCTGAGCACGGGATCCACCGAACCGACCCCTTCGCGTGGCATTGCCTTCATGCTGGACGCG
TTCAGGAAGCACGCGCTAGGTACAAACTTCGACTTATACGTTGATGAGGTGAAGCTGTAGTAGTATACCTACCTCGTGGCGATGTTTTGCGTGTGCAGTG
ATCCTCGTGGCCATTCTGTTCGCCACCTATCGCCTGTCACGGCTGGAAAGCGAGCGCGGACGACGCGGAGCTAATGTCGAGCGAGATGTGAGTCGAACGC
CGCGGCTCCTTCAAGTGAATTGTCAGCACACTCCCGCTGTATCTGACGCGCCCACAGTTTGAGAATGTCGTAGGCTTCCTGCACCAACGTCTGGATACAA
AGTACAGAGTGCTACGCATTGAGCCGCCACCGCATTCCACGATCAAGCTGCACGCGATGGTGGTGAACGGAGGGTTCGCCATCCCACACGTGGGTACGTT
GACTGCACGGACTTGGTGCTGGAGGCGTGATGAATCCTCACATGTGTGTGGTTCAATTTGGCACGCGTCTTGCCGAGAAGAAGCCGAGGTTTTCGTGGAC
CAGCGGTTTGTGCTTGACCAGCGCAAACAACGGCGGCGAGATGTCGAACCCTTGCCGCTGGTACGCTTTCGGGTGTACGATGTGACCACGATGACAACCA
TAGCTGAGGTAACTTTGCACTGTATGCCCCGGGTCTGCTTTGTTTTACCAACGTCTGCTCTCTTGTTTCACAGGATCTACAAAAGCGGAAGCTCATCGCT
TCGTATGAGCAAGGGTATCAACCAAAGTAAGCTACTCGTTGCTGAACATGTCGATCTCTTCCTCTGCGGCGTTAGATTCGTCGTTCGAGGCGCTTGATTT
GTCTACTGGTATTTTGCTGCTCTTGAGGGCGTCTTGCACCAGGGCGTCAGCCTTCCAGCCGAATTGGACGACAGTAGCGGTCAGATTATCTACGCTACGT
TTCGTGTAGGCAGCTTTAACGATCGCGTTTGCAGCGGCTTCGGCATCCTGGAAGTGTGGTAACGCGATATCCACGACGTCCTGGTTGCTCAAGACGTCCC
AGACGCCATCGCATGCCATCACCAGAAACAAATCGTCTTCCTGTACTTGAAATCTCGTGACCTCCGGGTCACATGAAACCAGCGCTGTCGGTGTCTTTAA
AGATCGGTCACCAAATGCCCGAACGTGGATGCCTCCTGTTGTATGGTCAACCCAGCGCCCACAGCAGAGTATACGCGGGATATGCCAGCTTTTCTCCCAC
AAAACCTCCAGCCTTTTCAATGCGCTTCTTTTCGTCCGGACGACTGGGTTTGTGGTCACTTGTGAGCGGCACAGCGTGCCCACCTCGACACAGAACGGCG
CGACAGTCTCCTAGGTTCACTGTGTAGAACATTCCTTCATCCGTTAGCTCGCTGCTGCCTCTAGCGTCTACATCGCGAACACTGCGGCTAGTCGAGTCGG
CTAGAAACCAAACCAGCAGAGCGGTTGAGCCGTCTGGTGACGGATTTTTCTGCAATATGTGCGCATCAACTCTCGTAAAAGCATCTTTGAATGCCCCCAC
GAAATGGCCGTGCTGTTCTTGGCACCACTTCCACCTCTTCTCATGACGTGCTGCTTCTTCGGTATCAATCTGCTCCATCTAACTCTCCATCTGAGAAATG
GCACTCGTAAGTTGATCAAACAGCATTTCCAGTTCGGGATCTGTGGCTCCCAATCTCAGAGTTTCCACTTCAGTAAGCTGCTGACGTAGCAGATTTTTCT
GCTCGACGATAGCATCTCGGCGAACGTTTTCTTGGCTCGATAGTTTGCGGCAGGCGCGAAGATCAGCTAGCGCTTTCTCGCCAGTATTTTGTCGTATCGC
TGAGGCTACAGTCTTCAGAAGCTGTCGAGATAGAAAATCTGCTGCAAATGTTCCGCCATGGCCGTCAAATACACCAAACACTGGACCAGGGAAGAACTCG
GTGGAGAAAACGTTGCGGTCTTCATTGGTAGTCTTCAGTCCAGCCCATGACTCTGTAGCGAACCGAAGCCGAGGAATTGAAAAGTCTGCAAGCTGCTGAC
CCGCACCGTGCAGGTCAGCACCGAACCACCCTTTTTCATCGGTACTTCCGCCATCGCTACCTGCCTTTAGCTTCCTGTCATCCTCAGCATCATCCTCGTC
ACGAACCTTCCGCTTTGATAAACTCTGCATGTTGGATGTGTGAAGGGGTGACCCCTGACGTCTGCTCTAAGATCTGGTGTATGGACCGCCATATTTCGGG
CTTAGCGACAATCAGTAGAACACACTAACGGCAAATGCCAATGGATTGCAGCTCTACTCGACGGGGTGTAGCTGAAGTCCAGATCGTGCAGCGGATGACC
CTGTCAATCCACGGTCGACATCGCACAAAAGCGGGCAAATACTATCATAATAGTTTGATTCACCACGAAGCACAAGTTATAGGTCAGAACTGCGCCTTCA
GAATAAAAGTCATTGAAGAGTCTTACATGGAGTCCGGGTGGGTGGAAGGCCATTGCATCCACAGGTCTTCGACTGCGCGTAGAGCACTCTCGTGAAGCAC
CACCACACAAATTGCGTCGTATCCACCCGCTGAAGATCATAAGAAACACATCGCTGGTCAGTTCAACATTCACCAAGCCAGCTTAACACACCAAGAGTAG
CAGTACCTCCAGGCACACCAGCAACCAAAACACCCGGAAGAGCGATCGTTGCATCGAGGATAGCCGTCTGCTCGGGTGGCTCGATCGGAACTCCTGCAGC
ATTTCCCATTTCACTGCAACGTCGAAAGAGGTCAGCTTATGTCACCGTTATGCAGTGTAATATTGAGCCTACCGCATGAGCTTTCGGAAATGGGAGAATG
CTTCGCTGATTCTCATGAGTATAGCCCCGATTCTAGCATCCGTAGTGCCCCACTGTACACACTCATTGCAGATCACACGCACGGAGTAAGTACAGCGTAG
CAGTACTAAAGAATGCTGCATCGATATACCTGTTCACGGCTTTGAGCCGCCATCGTTGCCCAATCGATTGGCGTACTGAGGCTGTCTTCCAGCTCGCAGA
TTTCCGCGAACCCTTGCTCAACCTCCGTGTTGTGGTGGTGGATTTCATCCATCACCTTCTTTGCGTGTTCAGGCTGTTCCTGTCTCCACTTCAACACTTG
CCGAACCATCGACACCGTCGCCGAACCGGACGAAACGTCTCCCAAGATCATGTGGAAGGTTGAAGGTAGTCGAACGGATTTCTGCAAGCAAGGACAACAC
ATTTAGTAAGCATAGTAGTTACTACAGTAACGTTGAAATGAAAGCCAGGACAAGCAGAGCAGCCATACCACACGGTTAGAAGTGTTCCACAGCGCACTGT
CAGTAATGCAACGAACAATTTCGCCCGATTTCATGGCATCTTCGGATGTAAATGCATCCAAAGTTGTTGCAGGGAAACGGGTATAGCGCTGGGAGCCAAA
GCATGCGGCCGATACATCAAATCCACTGCCGATCTGTAGAATACAATACAACAACTAGTTATTCAGCTGTTGTTGCTTCTAGGAAGGACAAATTGGTTAG
CCTTACCTTGCGTTGCACGTAGCAGTGGCTCAGCTGAGCCAAATTGTGCACCAGTTCCAGGTCTTTTTGCTGGGTATCAAAGTTCGCGGTTGGCACGAAG
AAGGCCACAAGTGCCGCAACTAGGGACGTCACCAGGGCGGCAGAGCTACCCATGCCAGTCTTCAACGCCACCATCTTGTCGCCGCGCTCTGAAAGGCAAG
TATCAGTACAAAACGTCTCTCAAGCATTGTCCCTGTGAAACCTACGTTCCATAGTTGGTGGGAGGAATGCGTTCAATGCCTTCAAGTTCGAGCGACGAAG
CGGCAGCTTTGCGTCCTGCAACTACACCCAAAACCAATGTCAGCGCCTTAACAGCCCATACCCCATCCATCCCTCCAACGTAAAGGTGATCATACTCTTT
TCACTTGGGAGTAAAAGTCGTTATCACCGCGGAGCGTGACGTGAGCACCCTTCTTCTCCTCCGCTAGTTGCTGGAACGTGTCGTTGCTCTTGAACTCGTC
CAATCCAGCAATGCCATTCACAGCACACAAGACTGTCTCCTCAATGTAGGAGTTCCGGTGCGAACCCTCCCTGCCATCACGCAAATAAGGTCATTCTGTT
TGACCCTTCACTAATCCGTACGTAACTCCTCGTCACCTGAGCTGGAATCGGAGTCGTCCATCGCCATTTTTCTCGATCCAGCCGTCGATCAACTGGTCGA
ACTGCGCACTCTCCACCTTCAACGGAAAGAGACGACGCCATTCGCAGTGGGAAGCAAAAATCGAGTCTTCTTCACCCAAAATCTGCATTTTAACGATAAA
TATTAGCGTTTACTAACTCCATTGTTGCAGTGATTGACACACGTACCTCAACCCCCACTTGGGAGTAAAACCTCGCCGTGCTCGACAAAACAAGCCCCGA
GTACTGCTCGTCCAGGACCAGGTAGCCGCCCACAAGCAGCACCTTGCCGGGCGCAGACACGCACGTGGGGCGGAGGTTCGCCATGCTCTGTATCGCCACG
TCGCCAAAAGTGAGCTCAGTACACGTACCTCAGCTTCAGCTTGTCATAAAGGGGTAGGCTTTATCTCTCATTGGTCACTTCATACGTAAAATCCTGTGAT
TGGCTCGATTTCAAACCTTACTTCGGGCCTTAATTCTGCGCCTAATTCCACTTGACGCCTCGCCTCAATCCGCCCTCCTCCTCCACCGGGCATGGCGTCG
TCCTCGGCGCCGTACGTGACTCCGTCTGTGGTCCCTACGGCCCCCCACAGCCTCTCACGCGCTCTATACGTCTCTTGTGTCCAGTAGGGAGCACGCCAAC
CCGCTGCAGCAGCGCGCGGCCGCCGCGGCGCAGGTGCGTAAAGTCCACCGCATTCTCGCACTCTTAGCAACAGTAATTCTGTTATCCTACCGCATGCTTA
CGCAACACATTTTCCATGGTTGCTATTACTATTGCTGCTGCAGGCGCTGCTGACGACGGAGCGCAAGATCTCGCAGCGGGAGATCCAGACCATGCTGGAG
AAGAACGAGGCGGCGCTGAAAGGCTGGAACGCTCTGCACAAGCAGCAACGTACGGACACACGCAGTACTATATGTACTAGCTAGTACCTTCTTACTAATG
TCTTTATGATGTCTGTTATTTGTTACGTTGCTGCAGCGGCCAAGATGAACCCGGCTGAGCACAAGGAGTGGGTGAGGAGGTGCCTGATCTTCCGGCAGCA
GATTGGAGCAAGGCTGGAGGTGCTGGCGTCGCTGGCGGACAAACAGATCGCCCAGGAGGATGAAAAGGCTGGAGGAAAGAGGGTCTCGCCGACTGCAGGC
GCTTCGGCTCAGAGGACAGGGGTGCAGCCCGATCCAGCGTCCACAGGAGCTGCTGCGCCACAGGTTCAACGTCAACCATCACCATCTATGCCCCAACAGG
GATACGCGCCGCCACAGGTTTCGACAATGGGTAGTAGCAATCCGATGGCGATGGCAGCGTCAGCATCGATGGCATCTGGATCTGCTGCACCTGCGTCGAC
CGTGTCGACTTCGGCGTCAATGGCGATGCCAAACATGAACTCAGCAGCACCGCCGACTCTTTTCCCTGAGCCCCCGATGCCGACGGTAGGATTCGCGTCT
ACGAGTACGAACATGTTTTTCCCGACGGGGCAGATAAACCCGATGCAGACCTCGTCTGGATTTTCGTCAACGACCTCAATGGCAGTGTCTGGTGTTACCA
CGTCGACTCAAGGTTACGCAATGAGCTCAGGGGTGCAGACCTTCACGCCTAACGCGTACATGACCTCTACCAGTGGGGCACCCAACGCGTCCGCTGCATT
TATGAACCAGCAGAACTACATGATGGGCGGTGGGATGATGAATCCACAGCAGCAATTCATGCCAATGCCCATGCCGATGAATATGGCACCATCGAGTGGC
GGCAATATGTTCGGCAACAATTATGGTATGTCTTCGGTGCCGACGTCGGCAAGCAGCTCCAACACCGGCAACAGCAGCAGCGGTAACAATTTTCCTGTGG
ATCCATTTATGACCCCGCTCGGGTTTAGCCCCGATCCAAGCTTCGGTTCAAGCGGCTTCCCGATGGCTGGTATGGCTGGTATGTCGATGCAACAACAGCA
GCAGATGATGGCGTCTATGAGTGGTGGCAATTTTGGAGCACAAGGCGCATCAATGATGCCCAACAATTTTGGTTATGGGGGGATGTCGACTGGCCCAACG
TCTTCATCACAAAACATGATGCCGCAGGCACTGCCAAATCAGCAGTTTCAGCCTGCACCTGGTGGACTACAACCTTTTCAGCAACAGAATCAGCTTCCTC
ACCATCCACCACAGCAACCCGGAGCAGGATCCATGAATATGCCACCAGATTCTGCACTATATGGTGACAGCAACGTTAATATCTTCGAAGGACTGACAGA
TGATGCCTTCTTTCCAATGCAATGACCAACATCTCCTCATCCCTGCCGACGTGTTCCAAGTCCCCGTTTCGTTGGTGCGTCGTTACTGCGTACAGTGCTT
GTTCATCATATCGTAATCTTGACGAAGCAAGTCATATAATCGTTCTCGTCGCACAGACACATTAGCAGACGCACGAAGGCGCAAGCGAACTGAGTTCGGG
ATATTTCGTGATACGGCGCTGACACGACCGACGCATTTGCTGCCAACGAGCACCTCGATTTTGTGCGCTTCATCCCAGGTTTTGTGAGCGGTGGCAGCAG
CGCGAGTTTCTGGGTCAATCAGCAGCTCGGCGAGTTTTGGAAGGCGAAAGGGCCTGTGCTTGGACTCGACTGAAAACCGAAGGGGGGAATGCTGCTGTTG
AAGTTTAAACTGATCGGATGTGTTGGCCATTATCATTGAGGCGGAGACACGATCGGGACTTCGATATTCTTGAGGTGGCGCAGGGTTGTGCGAAGTTACA
AGAGGAACAGGCTGTTGTTGCGTGTGGTAGTGCACGGCTTGAGGCGAATTCACGAACGCTTTGGAGCAAATTGGCTGGCGCGGCGGATCGTTGAAGTTCT
TCAAAATGGAAGCTGTTGACTGCAAAGCAACAAATGCTGGCGATGAAGCTGACGCGGAGCTTGCTGGGTTCGCGATTGAATATCTGGGGGCCGGGGGATG
TAGGAGCGAGAAGTGCAGCTTGGATAATGATGCCACTTCGGGTTGAGCATGATCTATCTCGCGATACTTTTCAAGGAAGGATTTTGCAGCTCCACCGTCT
TCTTGGTCGTGGACCACGTCTCGAAATGGATCTTGATTGCCAACGTACCTTTCATATTGGAAGAGGTCCTTGTGAGCGAGGAAGAACGCTCGTGCTGGCG
ATGGCTGTTGTTCCTCCATGCCAAGAGGCGGTTTGGCAATATGGAGTGACCTTTTGGTATTTCGGGATCGCAAGGGTCGGCTTCATTCATCTCATAAAGG
AGATCATGAAGACCGAGAGCTCGCTATCGACACCTCCCACCCTCTCTTCGTCACTGTCGAGTGCCCCCTCCTTCGTGCGGATCGGAGATGGCTCGTATTC
GCCTGGAGATCTGTACGTCGAATGCCTCCTTCCGAAAGTCCTCGTCAAGGACCTCAAGCCAGAACCAGTTCGCGCATCGGATAAATCCAAAGGCTGGGAT
ACGAAGCACAGAGGTAGCAGCTTGGGCAGCAACACGAGCTCCAATGCCAGCATCTTGTCCGAGACGGTAGTGCTACCTTTTGCAGAGCACCCCGCTATCC
TGCAAGCGCAAGAAGAATGCCGCTGTCTCATGAATGGTAACGACGTGTGCGTTCTCGAGGATGAAATAGTCAAGGAAGACGTGGTGCAGGTGCTTGGCAA
CGACGCTGAGCTCGTGTTCCCTACACGCAACATCTTCCGCTACCTCGTGATGTTCATCAAAAACATGGACCTGTTCCTCGAATTTCAGGTCGAGGTTCTG
GACGACTCGCAGAATTATCGGGTGTTCACGGTGACCAACACGCGGTCGTTGGCACGAGTTGAAGACACAGCGTGCCAACTGCCGCTGGCGTTCGGATCGC
ACCCAGGGTGGCGCTACCTCTGTATGGACCTGCAGGACCTCACAAACCAAGCGTTCGGCACAAGGCATGTGACGACAACGGAGGTGCGCATTCGTGGCAA
CTGTCGCCTTCTGAGAATGTTTTTTCAAGACGAACGCTACGCTGATGCCGATCTGCCAGCACACCTTACCTTCCTTGGCGCGTAGGTGTCGATGAGTTAA
GTCTGGAGGGAGGAAAGCAACACGAATGCTCGTTGGTTCTTAAGTTTTGTGAGACTGCTCTATTTCCCGTGCAAAGACCTTCATCCAGCAGCAATACGAT
ATCTCTTCTCGAATGCCTACCTACAGATACGACAGGTTGATCGTGTACTGCGGGTCTCGCTGGTTGCGCTGGCGCGATACCTCAGTAAAGATGCGGTGAT
TCAGCCAAAGCGACTCCAGATACCGGTAGCGAGCCACATCGAGACGGAGCGGCCGGCCACGTTGGAGGCCAATGTCTTCTTCACCATGCGTATCTACGTA
TGGGCTTGGGAAGTAGGCTGCCATGCTGCCGCCCACAACCGCGATGCGGCACTGCTCGAGCAAAAGCACAATGCCGACTCCTCCTCCACATTCTGCAGCG
TGCCGGGTGCACTCGCCTACAGGCGGGCCGTGTGGCATGAAGGCACGAGTGCAACACGAGTCTCCACAGCACAGAAATTCACCGCAAATCAAACAGAGGC
CTGGGTCACAAGGAGACTTGTCGCACCTTGTACACTTCCGCCCTGCCATTTCGCTGTAGAGCTCGTCGTACTGGATAGGCAAGTCAATCAGGCGTGGTCG
TGATGGCACTTCGCGAAGGATGAACATACTCGCCACATAAGCCTCGCTGCAACCTTCTGTGTGTTCGCACTTGTCGCCGACCTTCGAGCTGCCCAAATGT
GTCTTGCTGAGCATGCGGTCCATACACCATTGCCAGATTTGGTCGAATGTAGCATCCGAACTGTGGGCAATATCGACCAAGGTGGGGATCTGCATTGTCC
TAGCGTTTGCCGGATCGTTAGCCTCCTTATCCGCAAGGCAGCGCCAGAAAAGTTTCATGCGCCGAACAAACGCCGCATTCGGTGTCAAAATGCGCTTCAG
CCGCATATTGATATCGCCTGCAGAACTGAGTGGCTTCAGCTTCTCGGAAGGAAACGCCTTAGCCATTCGCAGCAGAAGCTGTAACACAGCGTACGCTTCA
GAGCCGCTATCTCCGGCAGCTTCCATCGCTTTCATGAGTTGCTGTACGGAGCCAGAAGCAGTCGTAGCACGTCGAGTTGATGCCACATGGCTGATTGCAC
GCCCACTGCGGGTTCGTCGCGAAGTCATACTCTCATCAGCACCTTCTGCTGCTTGAGAAGCCATCTCAATCTCACTTGCTTCAACAACGGAGAACTTGTC
TTGAAACAGTGATGTGCCCTGTGACTTGCTAGGCTCGAAGAACTCGGCATGAAGTCGTTGCAACAGATCTGCTGCGGTAAAAACCGGGATAAACTGCCAA
ATAGTCTCGAGCTCGTCTGCGATCACGCAAGCAACGACGAAAGCCTACAGTAGACAAAATACTATTAGAGCCTTGATCTAAGGCGCGACGCGAAGTATTT
GGCTTACCGTGAATGTGTCCGCTACTAGCAAGCCCAGGATCGTACCCCGAAGGCAAGCATCAATAGAGCCGAGGACCTATTACACCAAGAGAATATAGAA
AGTTAGATCCAGCATAACTGCATACAAGATTCAAGTAGACCAAACAATCTTACCTTTGTGAACTTGCGGTAGTCGCGCTTGGTTTCAGTGTTGATCGGGC
AACAGCGTTTAGCTGTCTCCCAGATGACCTTTGCGTCGGCACTGTGCTCCAAAAGGGAAAATGTCCATCGGCAGAACTTCGTGACTGCTATTAGCGACTC
CATCTCCTTCTCCAGAGACGGTGGACAGGGATCCGCAAGCGGATCGAACGGAGCAGGCGACCCAGATGCACTGCGATGTTCGTCATCAGCAACAGTTAAG
AAAGATGCCAACGTGAAAGCACACGCGGACCATAAGAAAGGTGCGCCCTTCTCAAGGCTACCATGAGGCTCCCAAAGCGTCTCCTCGAAGTAATCCCGCC
ACAAATCATGCTCAGTTTCATTTTCGTCGTCTTCAAATCCTCCATCGCGCCCAAGCACCGAACGATACCACCCCGGCATCGACAATTGCTCCTCCACAAT
TGTGTCCCATGTTCGAGACTTCGTTTCCTCGTCTCCGGACGCAACTGCAGAGCGTTTACTGGTCATGCTCGTTCTCCTTTACAATCGAGAT