Description :
From Genome Similarity Track
Location :
Scaffold_784:7100- 9814
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_784-snap-gene-0.8Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_784-fgenesh-gene-0.4Aly

Sequence
2714 bases(100 bases per row)
ACCGCTGGCGTCTCCGGCTGGAACTCGTTGAGCACGTCATCCCAGTCATCCGTGGCGGTGGCCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTTGGATTCTGGGTGAGGGGCTAATCAATGCGCGGACTTTGGATGGTTCCCAA
CCATTGAACCTCGACATAAGGTTTTTAACGGATGCAAATGTCGAAAACGTCGGAATTGTCGAAACCAGTAAGTGAATCATTTTCGACACGTGAGAATGGA
AAAAAAAGGTACAAAAACAGCCGCACAGAATGCGCGCAGCAACTTCTTCATGGGATCAATGCACCGAAACGATCCATTGGTGTTTGCTACTGTATCTGAT
CTTGCATAATGGGAACAGTGCTATCAATTGAATCACCACCCCTACCTTCTCACCTCAAGCCAAACTGGAAGACACCCAGCTCTAGCTTACTACCTTCCGC
CGTTCAAACTTCTCAATAGCTCACCTAATAAGCACTATCAGAGAATTGCTTGATCGTATTCAGTCGAAAAAAAAAGCAGGTATACTGACTGATTCAACCT
ATTGTATTCTATCGTCTCACACTCAAATTCAATTCAGTGTTGCCATATTTCATTTTAAAAATGCATGCAGACAATCAGATAAAGCACCTGAGGCAACAGC
ACCGTAGGACTTGCTTGTGAAACACGACGAATGCCGTGCTTGGCGGCACAAAACTGGCTGCATGCATCGTGTTTGGTTCGCTAGCTCACGCTGGTCTCAT
TCGTCACCAAATGCCGGGAAGGATCACCTTTCGGTTCTTTGGATACGTCTCCTTGAACTTGTCGAGGTACCACTGGTGGTTGCTGACGGCGCGCGGCACG
AGGTTGGTCGCCGTGTAGAACGCGAAAGACAGGCCCGCAGGTGAGCCCGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTCGAGCAGCTCGCCGAA
GTAGTTGGGCGCTGAGACATAGGCAAACATACCGCCGTGCGGGACCGAGTAGCCCGTGTCGCCCGGCTTGCGCAGGTTGATCAGCACGTGATCGGAGTGG
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCGGATACACGAACGCGCGGTAAAAGTAGTGGCAGCACCAGAGCGATGCCGCGACCATCGGGGTCGTCAACGTCCGNNNNNN
NNNNACGCAAACCAAAGAGCCGACGGCATCTCCATAAGCACCCAGCCGAGTCGGGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTACGGTGCGTTGATGAGGCTCGTGGCGAGGTACGTGATGACGCCGAGCGCAAAGACGCCCTTGATGAG
CCACGCGTGCAGCTCCTGCTCGCTCCAGTCCAGCGACGGGATCAGGAGGTGAGCCATAGCCTGCGGTCTGTTGCTCGTTTTGTGGTATGCTTGTCAACTG
CTGATCCCTTCGATGGTTTATGCGACATGTAACGCCCACAGTAATCCCAATTCCAGTCCCAATTCGTAATCATGCTGGTGCAACGAATTATCCGGATACG
GTGGAGGCTGTCGTCATCCGGTCGAAAATGCAAAGGTGCAAATGCGATGTGGTGTGTGTTATGACCGTGCTACGGTCAACCTGCCGCAGAAGAGCGCATA
CCTACTGCAGTAAAAGAGTTTATTATTCGTTAGCTTCTAGGTTATTAATCTTCAGCACTGAAATCTTGTTCGCGTGCAACCTTGGTCCACCTTCAACTCG
TTGATCTTCGGTCTCTTGGCTTGGCTCAATGTCGCTCCAACACTTAAATTTACGCAAAGGGAGTACCTTCTGCTTCTGCATCCTCGCACGTGGAACAGGA
GAAGAAAGCAAGACGATCGCTTGCGCTGCAAACCAAAGGGTTTCCGTCGCTGATTGGTAATGGTGGCTTGTTTGAACTTGGTTGGCACCGCTGGAACTTT
TCACAGCAGTTCACTTGCTGGCGACAAACTCACAGTAGCTTCTGGATTTTTCGCGCGGTATTTGGTCTCGGATAAAAAGCTCATGGAAAGCAATTGCATG
CTTGGCTTCTGATCTTGGAAAACTGATGGTTATTGGGTGTCTGCCATCAAAGCTGCAACGGGAAATAAGAGTCTCGACGCGGACGGAACACAATACAGAT
AGACGCAACTGGAGCATCCTTCCACGAGCACAAGTCAACCAAGCGCACGGTCCGTTTCGCGGATACCTAGGCTCGTCTCTCCGTTTTCACAGCAGATCAG
AAGCACTCGATCGCTTTCGCCATTGTATGGGAATGGGGTATATTTCGAACGGGGCCGCACGTGCTGGTCTCTGTCCTCTCCATCTCTCGCTCAAGCCACG
CTCGCTCTGTTCGACTTCATCGGGACGGCGAGGGACGAGTGAACCCGAGACATGTGAGTCCGTTAAAGCCAAAAGATCAAATTCAATACGTAACAACTAT
GTATATAAAGCAGA