Description :
From Genome Similarity Track
Location :
Scaffold_228:710- 2648
Sequence
1938 bases(100 bases per row)
GATGATGCTGTACTCGTCGGTTGATACTCGAAAGAACACACACGGATCCGCAGCAGTGCTTCGAAACCCTTGATTCTCCAGATGATGGTTAAGCTTGCTG
TTCCACTGCCGCGCCGCCTGTTTGGTCCCGTATAACGCTTGCTGCAGTAAACACTTCTTCGATGGACTTCCTTGATCTTCAAAATCATCAGGCTGGTCCA
TGTAGATCTCTTCGTCGACCTCACCGTAAAGGAATGCTGTGTCCACGTCGACATTCTCCGCCTCCAAGTCTTCCGCCGCTACAATCGCCAGCACCGCATT
AATGGATTCTTTGCGCGCGACTGGTGCAAACGTCTCATTAAAGTCAATTCCAGGACGCTGAGTGAATCCCTTGGCAACCAAGCGGGCCTTGAACTTTACG
ATCTCGCCACTTGGATCCCGCTTGATCCGAAATACCCATTTGCATCCAACAGCCCTTTTGCTAGGTGGCATGTCCACTAATGACCACGTGTTGTGATCTT
CTAGTGCTTTCATCTCGCTCTTCATAGCGTGTAGCCACTGCTCCTTGTGCTTGCTCTTTATCACTTCTTCATAAGTAGACGCTTGTTCTCCATTGCCTTC
AGCGGTAAAGCAGTGATGAGACTCGTACTCTCCCTCGAAGTCGTCCAGCGAAAAATCTCCACGACGTAAATTCGGGAACTCTTGGTCGTAGCGCACCACA
CCACGCTTCTTTCGAACAGGTCGCACCATCCACTCCTCTTCTCCATCACGTCCAGGTGTGCTGGATGCTTGGGTCGGGATAGAGTGTAAGGGTCGATCTT
GTTCGTCTTGTACCGGCTCATGTTGCGCTTGCATTCGTGGTGTCTGTAACACTTCATCTGACGCAGGCGCCTCCACGACATCTTCAATAACGTCGATTAC
CCGCATATCTTTGTTATGCACGTCCTTCGAAACCGGGTGCTCAGCANACGTCACGCTCCGTGATATCACTATCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN