Description :
From Genome Similarity Track
Location :
scaffold_1764:710- 2328
Transcript NameFunction/comments
g11676.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1618 bases(100 bases per row)
ACCTCCAGCATTGGTGTGTGGGCACACCAATAGCTACATGGGCGAGCCACCTCGATGGTTGGATCGCATGCATTTACGCATGTTATTGGTAGAAACTTAT
GGATTTCTACCAATCAGTGCTTGGCACAAGGGTATGGGTTCTGCCAACCACACGTTGGCAGACCCTTTTGAAATACATAAACAGATTTAAGAGGTTCGAT
AATTGGCTTTTGCCATATTCAATAACAGTTCTCATTTTACGGTATTTCTGCAGTTTAATTGCTTTATTTAGTTTAATTTATACTTACTGAAGTAAGTATA
ATTAATCTAAGTCAAACTAATTACACACTTCCTCATACACGTAAGCGCACGTGTACGCCACCTAGTGGGTCTAAGTAGACCCATTACACCTGGTAGTACT
TTATAATCCGTCCCACGACCGACTGCAGTTCGTTCGTATGGAGTCATACGAACGTGGGGTTGAGAACCTCCCCATGGATGAGGAGTCCGCGGGGACCCCG
AACATGTCCGTGACGCGCACGAACTGTGCCCACCTGTCGGACCCAGAGTGGGAGGCTCTCCAACGACTCTCGTGAGTCATTGGAAAGGCGGCGGTAGCGA
CGATGGTTTGTATGCTATCGGCGACAGAGCAACACGGGGTTGCTCTGGGGTTCATTTTTTCAGGAGCAACGCAACGTTGCTTCCTCGATGGCTTCCCCGA
AGCCGCGCGTGGAGTCGTTGAAGCTCCACGTGAGTACCTACACGGGGAAGGAGGACGAGACCCTCCTTCGTTGGCTTGTCGAACTCGAGACTGCCGTAAC
GGCTCGACGCATCGTCGACCCGCTGTCGAAAGTTGCGTTCGCCATGTCGTGTCTTAGCGGACGAGCGAAGAGTTGGGCCTATGGGCGCCGACTCTCGGAT
CCTACGTGCTTCAGCACGTACGAGGTGTTTAAGGAGGAGCTCAAGCTTGCGTTTGAGCCCCCGAAGAACGAGTTCAGATCGAGGGCGGAGTTCCTCGATC
TGGAGCAGGGCAAGGATGACGTGCATACCTATGCCCAGTGTGCTCGATACTTGGTATCGAACATAGTGACCAACCCGGTCGACGAGGCGACCAAGGTAGT
CACGTTCATGAAGGGACTGAAGGACGGTCCCGTCAAGACGTACCTCTTCCGAGAGTATCCGAATACTCTCGAAGAAGCCATCAGTCTTGCTATACAAGAA
GAGTTTAGCCGGCGTCAGGCTAAACGCCATGCGAACGTGCCGAAGCCGACGCGTCCTGCAGCAAGGACGGGAGGCCCAGAGCCTATGGACCTCTCGAGCG
CTACGACTGCTGGTCAACAGCAGCGTAATGGTGGTAAGGTACGATGTTACAAGTGCAGTAACATCGGTCACTATGCACGCGAATGCACAGCGACTGTGCA
GGGGGGGGGGGGGTCAGCGCCGCGATACACAGTATCGTGGCGGGCGTTCAAAAAAACGCCAAGGACCAGTAGGCGCGGGGCGTCCTACTGATAATGCAGT
CGCGCGTGTCGAGCTTGGACACGCGTCAATGAGGACTGCTGCCCCCAGCGAGAAGGTTTCTCGCTGCAAGAAGCAAGATGACAAGCCAAGTCTTGTCATC
CTGGATGTTATGTCGAAG