Description :
From Genome Similarity Track
Location :
Scaffold_1361:710- 2159
Sequence
1449 bases(100 bases per row)
CAGGAGGGCCATCCGTCGGATCATTGTCTCTTCATGTACCGTGCCTGCGGCGAACTACATGACGCCGGCAAGTGCCCGATGGAGGAGTTCTACAACTTGA
TCCGCCAGTGATACAACCCCAGTAGGTATGCAGGGATGTTGCCAGTCAACGCGGAGAAGATGTTAAACTAGGACGGTCGTCGGGTTTGAATCCGATACGA
GCCGAGCGTTCTAAGTACTGCATATTTGCATTCATGGGCAAGACATCGGTAGATCAAGTTAGCAAGCGGCCAGATCTACACGGTAATACATGTGAACTGC
ATGAGAAACGTACCGTGGTGATCTCAAGCCTGCGGCTGAATGATGAGTTCGCCGGTCCGACGTCAAGGTAGCCTTGGATCTCCAACTCGGGGGACAGCGA
GGTAACTGGAAGCAACGGGATCCGGAGCAGTGGTTCGCCCCTGCCGAGAAGGAAGACACGTCGGGAAGCCCAAGCATTCAACAGGTCAAGacagcttggc
gatctggGGCGGGACGCTTCCTGATCTGCAGCCCGGGGAATCGCGAGGGTACTGGAAGTATCATGCTCCTGGAAAGTGGTTGAAGCAAGCCAAAGCCGTC
GCCAAGGTGAACAACGAGAAGGCCACGTTGCTATTTGGCACCGGCGCTGAAGTCTCAATTATAGACACCACCTTTGCTCGTAGGGTTGGGTGTGCCATAG
ACGAAAGTCAGAGACAAGAATGCGTCGGGATCGGAGAGAACACATACACGACGGTTGGACGTGCCACGATCAGGGTCACGTTGGCTGGATCGATGGTGTA
CTACTTCGACACTTGGGTTGGAGATCCGTCGGGACAGGAAGCGATACTCGGCATGGACTTCATGGTACCAGCCTGAGTCCGCCTCGATCTGGCAGATGGG
ATGTTCTGTCTCCCAGATGAGGTACGGATTCAGCTGCTAGGACGGCGTCCGCTATACGGCGCTGCGGTCCAGCATGCCACGCTTGACCAAGATCACGAAG
TGCCAGTCGCCGAGTCCGCGGAGGTCCCGATCCGATACGGCAGATCGGCTAGCGCGAAGCTCTGGATCACACGGGGTCCAAGATGGGTGCCGACCGCTAT
CAGGGGTCTGGGCAGAACGAGGTATCTGCGGATCACAAACGTGAGCGAAGAGAAGTGTGGTGTAGTGATTCGCCAGTTTCCGAAGGCTTCCGCTGATGTG
AACCGACTAGCAGGCGCCCAGCCAATGAAGGCTCGGTCGTGCGATTGGAGGGGTCTACGATCAGTGATTGGTCAAACCGAGTCACTAACGAGGGCTCGCT
GGGAAGATTTATGGTCACGAAGTCACTGAACCAAGGAGGTCCTTGCCTCAACACTGACGGATACCGGAACCTGAACTAGTAGTCACGTTCAGCCCAAACT
ACCTTGATTTGGGCTCCCGAGTGGTTTTGGAACCCAACACTATTTTTCA